ID: 1139618781

View in Genome Browser
Species Human (GRCh38)
Location 16:68119680-68119702
Sequence GTTAATTTAATAGGAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139618781 Original CRISPR GTTAATTTAATAGGAAAGTC TGG (reversed) Intronic
903582557 1:24382878-24382900 GTTAATTTAATGTTAGAGTCTGG + Intronic
904112088 1:28133983-28134005 GTTCCTTCAGTAGGAAAGTCTGG - Intergenic
905947484 1:41916377-41916399 GTTAATTTGATGGCAAAGTCTGG - Intronic
908858967 1:68461766-68461788 GATAATTTAATAGCAATCTCTGG - Intergenic
909205791 1:72756029-72756051 TTTCTTTTAATAGGAAAGTAAGG - Intergenic
911153184 1:94614884-94614906 TGTGATTTGATAGGAAAGTCTGG - Intergenic
911631460 1:100188253-100188275 ATTAAGTTAATAGGAATGGCAGG - Exonic
912887985 1:113496921-113496943 GATAATATAATATGCAAGTCAGG - Intronic
916871498 1:168919394-168919416 GTAAATTGAATAGGAAACTGAGG - Intergenic
917296701 1:173527143-173527165 CTGAATTTAAAAGGAAAGCCAGG - Intronic
917410703 1:174757270-174757292 TTTTATTTAACAGGAAATTCTGG - Intronic
917785772 1:178456082-178456104 GTTAATTTAACAGCAAAATCAGG - Intronic
917826962 1:178832557-178832579 GTTAATCTCATAGGAAAATTAGG + Intronic
919443991 1:197678042-197678064 TTAAATGTAATGGGAAAGTCAGG - Intronic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
1063310498 10:4947635-4947657 ATTAATTTCATAGCAAATTCTGG - Intronic
1063851171 10:10192386-10192408 TTTAATTTAAAAGGGCAGTCAGG + Intergenic
1064190927 10:13205103-13205125 GTTTGTGTAATAGTAAAGTCGGG + Intronic
1067264812 10:44731635-44731657 GAGAATTTAAAAGGAAATTCTGG - Intergenic
1068291821 10:55012881-55012903 CTTAGTTTAAAAGAAAAGTCTGG - Intronic
1068790369 10:61023813-61023835 GTTATTGTAATAAGACAGTCTGG + Intergenic
1069128993 10:64675403-64675425 GTTAAATTTCTAGGAAAGTAAGG - Intergenic
1069297843 10:66869288-66869310 GTTAATTTAAAAGAACAATCAGG + Intronic
1071363737 10:84877876-84877898 CTTAATTAATTAAGAAAGTCTGG - Intergenic
1073993390 10:109289283-109289305 TTGAATTTCAAAGGAAAGTCTGG - Intergenic
1074383475 10:112998998-112999020 CTTTTTTTAATAGGAAAGTCTGG - Intronic
1075843977 10:125530106-125530128 GTTAATATACTAGGAAAGCTAGG - Intergenic
1076290003 10:129338579-129338601 GTTAAATTACTCGGAAAGCCAGG + Intergenic
1077971752 11:7200480-7200502 AAAAATTTAATAGGAAAGACTGG + Intergenic
1080463056 11:32472471-32472493 TTTAAATTAACAGGAAAGTGGGG + Intergenic
1086037710 11:82436808-82436830 GTCAATTTAACAAGAAAGCCAGG - Intergenic
1088999023 11:115033401-115033423 GTAAGTTTATTAGGAAAGTAAGG - Intergenic
1089436037 11:118467663-118467685 GTTAATTTAAAACTAGAGTCAGG - Intronic
1092225945 12:6748466-6748488 GTTAATTTAATATTAAATTGGGG + Exonic
1092722014 12:11450699-11450721 GTAAATTTAATCTGAAAGACTGG - Intronic
1092865673 12:12758607-12758629 GTTCATTCAATAGGAAAGGCAGG - Intronic
1092961877 12:13603715-13603737 GGGAATTAAATAGGAAAGTGGGG + Intronic
1094582683 12:31748833-31748855 ATTAATTTAACAGGTAAGGCCGG - Intergenic
1096419906 12:51448216-51448238 GTTAATTTAATGTGAGAGGCAGG + Intronic
1096633855 12:52946309-52946331 GTCAATTTAATTCGAAAGACGGG - Intronic
1096732434 12:53625536-53625558 ATTAATTTAAGAGGACAGTATGG - Intronic
1099074329 12:78086326-78086348 GACAACTTAATAAGAAAGTCTGG + Intronic
1099810968 12:87581858-87581880 GTTAATTTAATCTGAACGTGTGG + Intergenic
1100341832 12:93686386-93686408 TTTAATTTAAAAAGAAAGACAGG + Intronic
1100930217 12:99599821-99599843 GATAAATTGATATGAAAGTCTGG + Intronic
1101620156 12:106378517-106378539 TTCAATTTATTATGAAAGTCTGG + Intronic
1102360792 12:112285862-112285884 GTTAATCTAGTAGGAGAGTTGGG - Intronic
1103033445 12:117636966-117636988 GGTAATTTAATAGGAAAAAATGG + Intronic
1103191453 12:119005422-119005444 ATTAATTAAATAAGAATGTCTGG - Intronic
1103328729 12:120138972-120138994 GTTAAGTTAAAAGACAAGTCAGG - Intronic
1108468698 13:50745817-50745839 GTCTATTTAATAGGAAAGACAGG + Intronic
1109236883 13:59832623-59832645 GATACTTTAATAGGGAGGTCAGG - Intronic
1109398261 13:61789403-61789425 GTGAATCTGATAGCAAAGTCTGG - Intergenic
1109655152 13:65381059-65381081 GTTAATTTAAAAAGAAAGAGAGG - Intergenic
1109750889 13:66689670-66689692 GTTAATTTTTTAGCAATGTCAGG - Intronic
1109825157 13:67709476-67709498 GTTAATTTACTTTGAAAGTCAGG - Intergenic
1109931163 13:69220640-69220662 ACTATTTTAATAGGAAATTCAGG + Intergenic
1110077058 13:71259188-71259210 GTTCATTAAATAGTAAAGTTTGG - Intergenic
1111677871 13:91409710-91409732 CTGAATCTAATATGAAAGTCGGG - Intronic
1116512664 14:45765745-45765767 ATTAATTTAATACGAAAATGAGG - Intergenic
1116977806 14:51134984-51135006 GTTAATTTAAAAAAAAAGGCCGG - Intergenic
1118752157 14:68815333-68815355 GTTATTTTAGTAGAAATGTCAGG - Intergenic
1120095917 14:80387507-80387529 GTTAAAGAAATAGGAAACTCAGG + Intronic
1123724291 15:23086735-23086757 GGTAATTTAATATGACAGCCTGG + Intergenic
1127340716 15:58040889-58040911 GTTTATAGATTAGGAAAGTCAGG + Intronic
1128602166 15:69005189-69005211 GTTGATTTAACATGAAAATCTGG + Intronic
1128709315 15:69859956-69859978 GTTAATTGAATGGAAAAGTGGGG + Intergenic
1134143129 16:11739547-11739569 GTGAATTTCATAGGAAAATTGGG - Intronic
1134383654 16:13751557-13751579 GCTAATTAAATAAGACAGTCTGG + Intergenic
1135105678 16:19646948-19646970 TCTATTTTAATAGAAAAGTCAGG + Intronic
1135266179 16:21027742-21027764 GCAATTTTAATAGGAAAGCCAGG + Intronic
1139618781 16:68119680-68119702 GTTAATTTAATAGGAAAGTCTGG - Intronic
1146356412 17:32138265-32138287 GTTAATATAATAGGAAAGGCTGG - Intergenic
1147469414 17:40645535-40645557 GTTAATGTAATAGCCAACTCTGG - Intronic
1149089072 17:52756127-52756149 GTTAGTATATTAGGAAAGTATGG + Intergenic
1153107274 18:1542301-1542323 GTTAACTCAATAGGAAAGGAAGG - Intergenic
1153306949 18:3640054-3640076 ATTAATTTAAAAGGCAACTCTGG - Intronic
1155487531 18:26362036-26362058 GTTACTGTAGTAGAAAAGTCAGG - Intronic
1155732202 18:29174637-29174659 CTTTATTTAATAGGAAAATAGGG - Intergenic
1155823780 18:30412581-30412603 GTTAATTTAATAAGCAAATTTGG - Intergenic
1157637768 18:49177859-49177881 GTTTATTTAAAAGGAAAATGAGG - Intronic
1158753418 18:60293324-60293346 GCTAATTTAATAAGAATTTCAGG + Intergenic
1158995741 18:62917517-62917539 GTTGATGTAATAGGCAAGGCTGG + Intronic
1164707041 19:30327405-30327427 GTTATTTTATGAGGAAAGTGGGG + Intronic
1165261707 19:34624603-34624625 GAAAATGTGATAGGAAAGTCTGG + Intronic
1165669704 19:37665185-37665207 GTTAATAAAAAAGGAAAGGCTGG + Intronic
1168496638 19:56857308-56857330 GTTACTTTAATATGAATGTTTGG - Intergenic
926954817 2:18283072-18283094 GTTGGAGTAATAGGAAAGTCAGG - Intronic
926967090 2:18426838-18426860 CTTAATTTAATATGTAGGTCAGG + Intergenic
927770596 2:25857673-25857695 GTGATTTAAATAGGATAGTCAGG - Intronic
929679272 2:43973155-43973177 GTTAGAATAATAGGAAAGGCAGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
933153948 2:78950123-78950145 GATAGTTTAATAGGAAATTCTGG - Intergenic
933539557 2:83621063-83621085 GTAAGTTTAATAGGAATGTCTGG - Intergenic
935202499 2:100870205-100870227 GTTGAGCTAATATGAAAGTCAGG - Intronic
936717390 2:115203893-115203915 GTTACTTTAATATGAAAATTAGG - Intronic
938818466 2:134929171-134929193 GTTAATTTAAAAGTAGAATCAGG - Intronic
939246683 2:139634120-139634142 GTTAATGTAGAAGAAAAGTCAGG - Intergenic
939258870 2:139781184-139781206 GTAAATTTATTAGGAGAGTAAGG + Intergenic
942111481 2:172687295-172687317 GATAATTTCATAGGAAAATGAGG - Intergenic
942172243 2:173299772-173299794 ATAAATTCAATAGAAAAGTCTGG + Intergenic
942855526 2:180542046-180542068 GTTAATTTACTGGGCAAGCCTGG + Intergenic
944977872 2:205077848-205077870 GTTGTTTAAATAGGAAAGTAAGG - Intronic
945828330 2:214751661-214751683 GATAATTGGATATGAAAGTCTGG - Intronic
945942554 2:215964181-215964203 GTTAATATAGAAAGAAAGTCAGG + Intronic
945992809 2:216410699-216410721 GTTAATTTACTAAGAAAGCTGGG - Intergenic
1169781057 20:9311124-9311146 GTGGATATTATAGGAAAGTCAGG - Intronic
1171942414 20:31343936-31343958 AGTAATGAAATAGGAAAGTCAGG - Intergenic
1172617079 20:36296205-36296227 GATGATTAAATAGGGAAGTCCGG - Intergenic
1173878327 20:46391129-46391151 GGTAATTTAATATGACAGTCTGG - Intronic
1179556530 21:42182061-42182083 ATTAATTTTATAGGACATTCTGG - Intergenic
1182389925 22:29984948-29984970 GCTAATATAGTAGTAAAGTCAGG - Intronic
949727289 3:7063892-7063914 GCTAATATAATAGGCAAATCTGG + Intronic
950266692 3:11578543-11578565 GTAACTTTAAGAGGAAAATCAGG - Intronic
951111523 3:18810018-18810040 CTTAACCTAGTAGGAAAGTCAGG + Intergenic
951402176 3:22246553-22246575 GTTAGTTTTATAGCAAAGTCAGG - Intronic
953322543 3:41984936-41984958 GCTAATTAAATAGGAATGTGTGG - Intergenic
953482494 3:43263468-43263490 GTTAATTTAAGAAAAAAGGCTGG + Intergenic
953584688 3:44188977-44188999 GATAATTTAAAAGCAAACTCAGG - Intergenic
953644979 3:44745513-44745535 ATTAATTAAATTGGAAACTCTGG - Intronic
955513410 3:59704044-59704066 GTTACTGTCATAGGAAAGTCAGG - Intergenic
957152242 3:76500418-76500440 GTTAATTTTAAAGGAAAATATGG + Intronic
959094583 3:101940033-101940055 GTTAATAGAATAGAAAAGTAAGG - Intergenic
959186961 3:103056911-103056933 GTTATCTTATTAGGACAGTCGGG - Intergenic
959400141 3:105890740-105890762 GTTACTTTACTTGGAAATTCTGG - Intergenic
959676702 3:109044084-109044106 ATTAAATTAATAGGATAATCCGG + Intronic
960016512 3:112895570-112895592 GTTAATTAAAAAGGAAAAACTGG + Intergenic
960267229 3:115634090-115634112 GTTATTTTAAAATGAAAGTTGGG + Intronic
961935382 3:130577333-130577355 CTTAATTTAACAAAAAAGTCAGG - Intronic
964847262 3:161057514-161057536 GTTAATTTAATAGAAAGCCCGGG + Intronic
965686721 3:171311716-171311738 GTTAAAATAATGGGAAAGCCAGG - Intronic
965872078 3:173276047-173276069 GTTAATTTGAGAGGTAAGTGAGG - Intergenic
966098468 3:176236648-176236670 GTTAATTTATTATGTTAGTCTGG + Intergenic
968207780 3:196819690-196819712 GTTCATTTAGTGGAAAAGTCAGG - Intronic
969120396 4:4904498-4904520 GTTATTGTAGTAGGAAAATCCGG - Intergenic
972078204 4:35114150-35114172 GTAAATTTAGTAGGATTGTCAGG + Intergenic
974497051 4:62644923-62644945 ATTACTTTAATATGAAAGACAGG - Intergenic
975500779 4:75082084-75082106 GTTAATTGAATGAGACAGTCTGG + Intergenic
975622634 4:76309084-76309106 GTTCATTTAAGAAAAAAGTCAGG - Intronic
975812516 4:78183566-78183588 GATAATTTGACAGGAAAGTAAGG - Intronic
976577958 4:86698283-86698305 CTTATTGTAATAGGAAAGACTGG + Intronic
977195909 4:94059308-94059330 CTTAATTTAATTAAAAAGTCAGG - Intergenic
978687736 4:111467579-111467601 GTTAATTAAAAAGGAAATCCTGG - Intergenic
978985516 4:115007542-115007564 GTTTGTTTAAGAGGAAAGTAGGG + Intronic
979446797 4:120823464-120823486 ATTTATTTAATGGGAATGTCTGG + Intronic
980191464 4:129530119-129530141 GAAAATTCAATAGGAAAGTCTGG - Intergenic
980956682 4:139435940-139435962 GTTCCTTAAATTGGAAAGTCCGG + Intergenic
982272622 4:153606597-153606619 GTAAATTTAATATGGGAGTCTGG + Intronic
982536698 4:156615881-156615903 GTTTATTTAAAAGGAGAGACAGG + Intergenic
983120393 4:163876817-163876839 ATTAATTTACTAGGTAAGTCAGG + Intronic
984249621 4:177316377-177316399 TTTAATTTTATGGGAAATTCTGG + Intronic
986799446 5:11244579-11244601 ATTAATTTTATAGGACAGGCCGG - Intronic
987385970 5:17329792-17329814 TTTAATTAACTAGGACAGTCAGG + Intergenic
987600185 5:20058331-20058353 ATTTATTGAATAGTAAAGTCGGG - Intronic
988342696 5:29994644-29994666 GTTTATTGAATAAGAAACTCTGG + Intergenic
990154579 5:52860964-52860986 GCTAATTTTATAGAGAAGTCAGG - Intronic
993178619 5:84519797-84519819 GTGAAATAAATAGGAAAGTCTGG - Intergenic
993428788 5:87804508-87804530 GTTAAGGTAATAGGAAATTCTGG + Intergenic
993583183 5:89689717-89689739 GTTAATATATTAGGAAAAACAGG - Intergenic
996507478 5:124284574-124284596 GTGATTTAAATAGGAAGGTCAGG + Intergenic
998451897 5:142241152-142241174 GTTAATTAAATAGAAAAGAGTGG - Intergenic
998538855 5:142960340-142960362 GCTAATTTAATAGGTAACTATGG - Intronic
998720672 5:144944633-144944655 GTTTGTTTAATACAAAAGTCTGG - Intergenic
999005408 5:147971094-147971116 TATAATTTAAAAGAAAAGTCTGG - Intergenic
999842137 5:155439305-155439327 GCTAATTTTATAGAAAAATCTGG + Intergenic
1003226277 6:4208717-4208739 ATTAATTTGGAAGGAAAGTCTGG - Intergenic
1003779885 6:9412701-9412723 ATTATTTTAAAAGGAAATTCTGG - Intergenic
1004881326 6:20011272-20011294 GTTAATCTGTTAGGATAGTCTGG + Intergenic
1004932573 6:20476413-20476435 GCTAATGTAACTGGAAAGTCTGG + Intronic
1005045041 6:21633899-21633921 GTTCATTTGCAAGGAAAGTCAGG + Intergenic
1008273634 6:49518475-49518497 GATCATTTAACAGGAAAGTAGGG + Intronic
1010190476 6:73190481-73190503 GTAAATATAATAAGAAACTCTGG - Intronic
1011457822 6:87570911-87570933 GTTGAAATAGTAGGAAAGTCTGG - Intronic
1011543796 6:88463109-88463131 GGAAATTCAATTGGAAAGTCGGG + Intergenic
1012128432 6:95459528-95459550 TTTAATTAAATATGAACGTCTGG + Intergenic
1013860177 6:114626083-114626105 TTTAATTTAATAGTAAGTTCTGG + Intergenic
1014265603 6:119273792-119273814 GTTAATTTGATAGGAAAAAAAGG + Intronic
1014574440 6:123053044-123053066 GTTAAAATATTAGGAAAATCAGG + Intronic
1016125144 6:140391808-140391830 GTTGGTTTAATATGAAAATCAGG + Intergenic
1017138994 6:151173520-151173542 GTTTATTTAATAGTTAATTCTGG + Intergenic
1017369602 6:153689577-153689599 GTTAAAATATTATGAAAGTCAGG + Intergenic
1018929320 6:168229820-168229842 GTTAATTGAATAAGAACTTCGGG + Intergenic
1022583505 7:31581688-31581710 ATTAATTTAAAATGAAAGCCAGG - Intronic
1023010298 7:35919748-35919770 GTGAATTTAAAGTGAAAGTCTGG - Intergenic
1023252563 7:38281139-38281161 TTTACTGCAATAGGAAAGTCTGG + Intergenic
1023647340 7:42331434-42331456 GAAAATTTAAAAGGAAAGACTGG + Intergenic
1025123935 7:56329847-56329869 GTGAATTTAAAGTGAAAGTCTGG - Intergenic
1026454661 7:70560185-70560207 GTTGTTTTAATAGGGTAGTCAGG - Intronic
1029866162 7:103631682-103631704 GTAAATTTATTAGAAGAGTCAGG + Intronic
1030449793 7:109693424-109693446 GTTAATTTATTAGGAATGGGAGG - Intergenic
1030660147 7:112209310-112209332 TATATTTTAAGAGGAAAGTCTGG - Intronic
1030974080 7:116099312-116099334 GTTAAATAATTAGGAAAGTAAGG + Intronic
1034384255 7:150725535-150725557 GGTAATTTTATAGGATAATCAGG + Intronic
1036446175 8:8823124-8823146 GCTAATTTGAAAGGAAAGTCAGG - Intronic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1039990564 8:42484325-42484347 GTTCATTTGATTGGTAAGTCAGG + Intronic
1040806953 8:51405726-51405748 GTTAATGAAAGGGGAAAGTCAGG + Intronic
1043254726 8:78120028-78120050 GCTAAATTACTAGAAAAGTCTGG - Intergenic
1045770424 8:105731909-105731931 GTTTATTGAATAGCAAAGTGTGG + Intronic
1047452249 8:124975121-124975143 GTCAATTTCAAAGGAAAGTTAGG - Intronic
1047971575 8:130089053-130089075 GTTCATGTACTAGGAAAGACAGG + Intronic
1048023409 8:130561814-130561836 GTAAATTTTATAACAAAGTCTGG + Intergenic
1049980397 9:898757-898779 GTTAAGTTAGGAGGAGAGTCCGG - Intronic
1050227646 9:3478783-3478805 AGGAATTTAAAAGGAAAGTCTGG - Intronic
1050371352 9:4924469-4924491 GTTTGTTTAATAGAAAAGTGGGG + Intergenic
1050926557 9:11270257-11270279 GAGAATGTGATAGGAAAGTCTGG + Intergenic
1051347271 9:16163532-16163554 TCTAATTTAGTAGGAAAATCAGG + Intergenic
1052464353 9:28811258-28811280 GGTCATGTAATAGGAAAGACTGG - Intergenic
1055935052 9:81597026-81597048 GTTCATTTAACAGCAAAGTTTGG - Intronic
1056070025 9:82976574-82976596 TTTCATTTAATATGAAAGGCTGG + Intergenic
1056419305 9:86408201-86408223 GTTAAATTCATAGAGAAGTCTGG - Intergenic
1058978904 9:110151063-110151085 GTTCATTTAATAAGTAAGTATGG - Intronic
1058988998 9:110236766-110236788 GACAATTCAATAGGAAAGTGGGG + Intergenic
1061338956 9:129963291-129963313 ATTTATTTTATATGAAAGTCAGG - Intronic
1061350777 9:130063024-130063046 GTTATTTTAATACCAATGTCTGG + Intronic
1061901755 9:133676460-133676482 GTTAATTTAATTGTACAGTTCGG - Intronic
1188359312 X:29233228-29233250 GTTACTTGAATAGCAGAGTCAGG - Intronic
1188366636 X:29323861-29323883 ACTAATTGAATAGGAAAGTGAGG - Intronic
1189112614 X:38308550-38308572 ATTAATTTAATAGGTCATTCAGG - Intronic
1189375048 X:40460015-40460037 GTTAATTGAAGAAGAAATTCAGG + Intergenic
1193093554 X:77521804-77521826 GTAAATTAAATAGGAAAGACTGG - Intronic
1193342296 X:80363317-80363339 GTTAATTTAACAGGAAAATTTGG - Intronic
1196315516 X:114218036-114218058 CTTAATTTAATGGAAAAGTCTGG - Intergenic
1196910230 X:120477395-120477417 GTTAATATAATAGGAGAGAGAGG - Intergenic
1198591127 X:138183471-138183493 GTTAATTAGTTAGGAGAGTCGGG + Intergenic