ID: 1139619261

View in Genome Browser
Species Human (GRCh38)
Location 16:68123889-68123911
Sequence GCGGGAGCATTGCCTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2799
Summary {0: 1, 1: 0, 2: 7, 3: 195, 4: 2596}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139619255_1139619261 -1 Left 1139619255 16:68123867-68123889 CCCAGGTACTAGGGAGGCTGAGG 0: 101
1: 10974
2: 220692
3: 282545
4: 181490
Right 1139619261 16:68123889-68123911 GCGGGAGCATTGCCTGAGATGGG 0: 1
1: 0
2: 7
3: 195
4: 2596
1139619257_1139619261 -2 Left 1139619257 16:68123868-68123890 CCAGGTACTAGGGAGGCTGAGGC 0: 77
1: 9579
2: 201050
3: 263747
4: 185944
Right 1139619261 16:68123889-68123911 GCGGGAGCATTGCCTGAGATGGG 0: 1
1: 0
2: 7
3: 195
4: 2596
1139619253_1139619261 7 Left 1139619253 16:68123859-68123881 CCTATAGTCCCAGGTACTAGGGA 0: 3
1: 524
2: 12994
3: 137789
4: 259476
Right 1139619261 16:68123889-68123911 GCGGGAGCATTGCCTGAGATGGG 0: 1
1: 0
2: 7
3: 195
4: 2596
1139619249_1139619261 26 Left 1139619249 16:68123840-68123862 CCAGGTGTGGTGGCACACACCTA 0: 148
1: 2606
2: 14290
3: 49784
4: 120477
Right 1139619261 16:68123889-68123911 GCGGGAGCATTGCCTGAGATGGG 0: 1
1: 0
2: 7
3: 195
4: 2596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139619261 Original CRISPR GCGGGAGCATTGCCTGAGAT GGG Intronic
Too many off-targets to display for this crispr