ID: 1139619569

View in Genome Browser
Species Human (GRCh38)
Location 16:68126643-68126665
Sequence TCTAATCATCACTAGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139619569_1139619571 -5 Left 1139619569 16:68126643-68126665 CCATACACCTAGTGATGATTAGA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139619571 16:68126661-68126683 TTAGACAAGTCTATTCAGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139619569 Original CRISPR TCTAATCATCACTAGGTGTA TGG (reversed) Intronic
909249779 1:73337403-73337425 TCTCATAATCACTATGTGTTGGG - Intergenic
910240679 1:85082711-85082733 AATAATCATCACTATGTATAGGG - Intronic
914945675 1:152063345-152063367 TCTCATCATCACTGGGTGTTGGG + Intergenic
916846443 1:168655345-168655367 TCCAATCATCAGTAGGAGAACGG - Intergenic
920437178 1:205954876-205954898 TCTAATCTTCATTAAGTCTAGGG + Intergenic
1064892381 10:20191891-20191913 TTTAAGCATCTCTAGGTATAAGG - Intronic
1065240886 10:23703060-23703082 TCTAATCGCCACTAGGGGGAGGG - Intronic
1066658360 10:37715692-37715714 TTTTATCATGACTAGGTGTTGGG + Intergenic
1068292203 10:55018134-55018156 TCTAAACATCAATAGGTTAATGG - Intronic
1080970982 11:37276495-37276517 TCTAATCACCAAAAGGTATAGGG - Intergenic
1087468022 11:98534930-98534952 TCTAAACATTAGTAGGAGTATGG - Intergenic
1089633773 11:119799351-119799373 TCTAATCTTCCCCAGGTGCAGGG + Intergenic
1090015551 11:123082992-123083014 TCTAATCATAAGTAAGAGTAAGG - Intronic
1091593405 12:1858718-1858740 CCTTACCAACACTAGGTGTATGG + Intronic
1095195055 12:39304835-39304857 TCTAATCATCACTGGCTCCAAGG - Exonic
1098498869 12:71167074-71167096 TATAATCATCACTATGTGCTGGG + Intronic
1101173024 12:102119766-102119788 TTTAATGAGCAGTAGGTGTAGGG - Intronic
1104224855 12:126821623-126821645 TCTAATCATCACTTTCTCTAAGG - Intergenic
1106364303 13:29062711-29062733 TGTAAGTATCACTAGGTTTACGG + Intronic
1110366962 13:74697705-74697727 TCTCATCAGTATTAGGTGTATGG - Intergenic
1113131726 13:107044348-107044370 TAACATCATCACTAGGTGGAAGG + Intergenic
1116250170 14:42471876-42471898 TCCAATCATCATTAGTTGAATGG + Intergenic
1116377498 14:44222136-44222158 TTTAATTATCAGTAGCTGTAGGG + Intergenic
1119733438 14:76965640-76965662 TCTGACAATCACTAGGTCTATGG - Intergenic
1130933574 15:88449888-88449910 TATAAACCTCACTAGGAGTAAGG - Intergenic
1135174190 16:20213486-20213508 TGCAAACATAACTAGGTGTAAGG - Intergenic
1135689803 16:24527111-24527133 TCTAATCTTAACTAGATTTAGGG + Intergenic
1139619569 16:68126643-68126665 TCTAATCATCACTAGGTGTATGG - Intronic
1154363975 18:13689440-13689462 TTTAATCATGAATAGGTGTTGGG - Intronic
1158028661 18:52935304-52935326 TTTAATAATTACTAAGTGTAAGG + Intronic
1162885161 19:13691614-13691636 GCCAATCATCAATAGGTTTAGGG - Intergenic
1168168161 19:54568935-54568957 TCTTATCATCTGTAGCTGTAGGG + Intergenic
925752969 2:7106244-7106266 CCTCATCCTCACTAGGTGTTTGG - Intergenic
927097918 2:19762232-19762254 TCTACTCTTCTCTAGCTGTAAGG + Intergenic
928035661 2:27820409-27820431 CCTAATCATCAATAGGAGAAGGG - Intronic
930605965 2:53493301-53493323 TTTATTCCTCACTAGGTCTATGG + Intergenic
933133392 2:78701260-78701282 TGTAATTATCACAAGGTGTCAGG - Intergenic
944897117 2:204176662-204176684 TTTGATCATCACTAGCTGCAGGG + Intergenic
945450211 2:209985693-209985715 ACTAATCCTCATTAGGGGTAAGG + Intronic
945660830 2:212683205-212683227 TCTCAACATCACTAGGCGAAAGG + Intergenic
1168903760 20:1387996-1388018 TGTAAACACCACTAGGTGAAAGG + Intronic
1171888775 20:30687170-30687192 TCAGAACATCACAAGGTGTATGG + Intergenic
1175308418 20:57994073-57994095 TCTAATCAGCGCCAGGTGGAGGG + Intergenic
1176420246 21:6508369-6508391 CCTCGTCTTCACTAGGTGTAGGG + Intergenic
1178660489 21:34503562-34503584 TCTAATCATGCCTTGGTCTATGG + Intergenic
1179695738 21:43116689-43116711 CCTCGTCTTCACTAGGTGTAGGG + Intergenic
1183083267 22:35470805-35470827 TATGATCATCATTAGGTGTTAGG - Intergenic
954043474 3:47908665-47908687 TTTAATCATTACTTGGTATAAGG - Intronic
956137950 3:66117453-66117475 TCTAAACATCACTAAGGCTAGGG - Intergenic
959240022 3:103779263-103779285 ACTAATTATCACTATGTGGAAGG + Intergenic
965138023 3:164799516-164799538 ACTAATCATCACTAAGTATTTGG + Intergenic
967046343 3:185740717-185740739 TCTAACCTTTACTAGGTATATGG - Intronic
968072817 3:195797603-195797625 TCTAATCAACATTAGGTTGAAGG + Intronic
975948218 4:79734907-79734929 TCTTATCATTCCTTGGTGTAGGG + Intergenic
976667668 4:87616547-87616569 TCTAATCATCACTGGTTGAGTGG - Exonic
979804837 4:124958501-124958523 ACTAAAAATCACAAGGTGTATGG + Intergenic
981583990 4:146280711-146280733 TCTAAACATCCCTTGCTGTATGG + Intronic
983255081 4:165389757-165389779 TCTAATTTTCACTAGATGTTTGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
987551687 5:19390686-19390708 TCTAAAGATGACTAGATGTAAGG + Intergenic
996582292 5:125044860-125044882 TCTAGGCATCACTTGGTGTAAGG - Intergenic
1001186015 5:169573579-169573601 TCCAATCATCACTAGCTATTTGG - Intergenic
1018526839 6:164721318-164721340 GCTATTCATCAGTAGGTGTTAGG - Intergenic
1021205175 7:17771357-17771379 TATATTCATCACTAGGGGAATGG + Intergenic
1036587770 8:10140951-10140973 TATATTCATCTTTAGGTGTATGG - Intronic
1038141085 8:24845760-24845782 TTTAATATTCACTAGGTGTGTGG + Intergenic
1038911354 8:31968247-31968269 ATTAATCATCACTAGCTGTCAGG + Intronic
1041777010 8:61534342-61534364 TCTAAGCATCACTAGATGGTTGG - Intronic
1047213752 8:122860507-122860529 TATAATCATCACTAGGATTGTGG - Intronic
1048436347 8:134422108-134422130 TCTGAGCATTACTAGGTCTAGGG - Intergenic
1053338909 9:37304807-37304829 ACTTATCATTACTAGTTGTATGG + Intronic
1196636238 X:118006102-118006124 TCTAATAATCACTGGGTGGTAGG - Intronic
1201428861 Y:13885065-13885087 TCTGAACATCACAATGTGTAAGG - Intergenic
1201737944 Y:17290462-17290484 TCTAATAATCACTTTGTGTTTGG - Intergenic
1202095175 Y:21242352-21242374 TCCAATCATCACTAGGTATCTGG + Intergenic