ID: 1139619589

View in Genome Browser
Species Human (GRCh38)
Location 16:68126912-68126934
Sequence GCTCATTTAAAATTTAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139619586_1139619589 30 Left 1139619586 16:68126859-68126881 CCGTTTTTCTGACAAACAAATAT 0: 1
1: 0
2: 1
3: 51
4: 692
Right 1139619589 16:68126912-68126934 GCTCATTTAAAATTTAATACAGG 0: 1
1: 0
2: 1
3: 27
4: 296
1139619588_1139619589 5 Left 1139619588 16:68126884-68126906 CCGTATTATATTTATGAATAAAA 0: 1
1: 1
2: 9
3: 96
4: 1186
Right 1139619589 16:68126912-68126934 GCTCATTTAAAATTTAATACAGG 0: 1
1: 0
2: 1
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139619589 Original CRISPR GCTCATTTAAAATTTAATAC AGG Intronic
900974299 1:6007632-6007654 GCTCACTTAAAATTTCAATCTGG + Intronic
901278816 1:8015214-8015236 CCTCATTTAAAAAATAATGCTGG + Intronic
901667556 1:10835340-10835362 GCTCTATGAAAATTTAATGCCGG - Intergenic
902315045 1:15612426-15612448 GCTTTTTTAAACTTTAAGACAGG + Intergenic
906052137 1:42883727-42883749 GTTATTTTTAAATTTAATACTGG - Intergenic
906760762 1:48375616-48375638 GCTTATTTCAAATTGAAGACTGG - Intronic
906918997 1:50043425-50043447 GCTTCCTTAAAATTCAATACTGG + Intergenic
906947135 1:50304522-50304544 GGTCATTGAAAAGTTTATACAGG + Intergenic
907253706 1:53161438-53161460 ACTCATTCAAAATTTATTACAGG - Intergenic
908057698 1:60308324-60308346 ATTTATTTATAATTTAATACTGG - Intergenic
908869806 1:68596395-68596417 TCTCATTTAAAATAAAAAACTGG + Intergenic
909306268 1:74082433-74082455 GGTCATGTAAAATTTAATGATGG + Intronic
909918936 1:81356175-81356197 GCTCATTTTAAATCTAATTGAGG - Intronic
910020403 1:82582369-82582391 GCTTGCTTAAAATTCAATACTGG + Intergenic
910254485 1:85234184-85234206 GCCCATCAAAAAGTTAATACAGG - Intergenic
910821939 1:91360199-91360221 GCCCATTTACAATTTAAGATTGG - Intronic
911965491 1:104364153-104364175 ACTCATTTAAAATATAAAAAAGG + Intergenic
912064134 1:105714344-105714366 GATCATTTAAAATTCTATATAGG + Intergenic
914864888 1:151418548-151418570 GCTATTTTAAAATTTACAACAGG - Intronic
914931277 1:151935898-151935920 GCTCATTTAATATCTAGTACTGG - Intergenic
917168338 1:172139839-172139861 GCAGATATAAAATTTAATTCTGG + Intronic
918599898 1:186344890-186344912 GCTATTTTAAAATGTAATACAGG - Intronic
918604798 1:186410714-186410736 GCCCACTAAAATTTTAATACAGG - Intronic
919032885 1:192267413-192267435 TATCATTTACAATTTAGTACAGG + Intergenic
919221543 1:194636441-194636463 CCTGATTTAAAAATAAATACAGG - Intergenic
921716270 1:218419985-218420007 GCTCACTTAAATTATAGTACAGG + Intronic
924785372 1:247192456-247192478 GTTCATTTAAAAATAAATCCTGG + Intergenic
1063612997 10:7579090-7579112 GCTCATTAAATACTTAATATGGG + Intronic
1064045867 10:12014366-12014388 GAACATTTAAATTTTAACACTGG + Intronic
1064881870 10:20064584-20064606 GGTCATTTATTATTTAATAAAGG + Intronic
1067179291 10:43972702-43972724 GCATTTTTAAATTTTAATACAGG + Intergenic
1068254328 10:54489884-54489906 CCTCATTTGAAATTGAAGACAGG - Intronic
1069372854 10:67765693-67765715 TCTTATTTAAAACATAATACTGG - Intergenic
1070249383 10:74760789-74760811 GCTCATTCAAAGTTCAATGCAGG + Intergenic
1071073128 10:81718272-81718294 GCTCATTAAAAATTTTATATTGG + Intergenic
1072706677 10:97686111-97686133 GCTTATTTAAAATTTTATAGAGG - Intronic
1073822410 10:107279717-107279739 GCCCATTGAGAATCTAATACAGG + Intergenic
1074256193 10:111804946-111804968 GCTTTTTTAAAATTTAATTCCGG + Intergenic
1074958159 10:118412807-118412829 ACTCATTTAGACTTTTATACAGG - Intergenic
1076042991 10:127267466-127267488 TCTGAATTAAAATTTAAAACAGG - Intronic
1078738853 11:14047933-14047955 GTTCATTAAAAAGTTAATAAGGG + Intronic
1079634630 11:22720807-22720829 GCGAACTGAAAATTTAATACTGG - Intronic
1081034291 11:38123313-38123335 TCTCACTTAACATTTGATACAGG - Intergenic
1081223137 11:40487675-40487697 GCTCATTTAAAAGTTATAAAAGG + Intronic
1081351120 11:42053514-42053536 TATAATTTAAATTTTAATACTGG + Intergenic
1085191020 11:74622662-74622684 AACCATTTAAAACTTAATACTGG + Intronic
1086335278 11:85794477-85794499 TGTCCTTTAAAATTTAAAACTGG - Intronic
1086880802 11:92151463-92151485 GCTCATTAAAAATTTACTCTGGG + Intergenic
1088038450 11:105347570-105347592 GCTAATTTAGAATATTATACAGG - Intergenic
1088129257 11:106467191-106467213 CCTCATTTAAAAATTCATCCAGG + Intergenic
1089804667 11:121073606-121073628 GCGCATTTTAAATATTATACTGG - Intronic
1090047328 11:123347423-123347445 GCTAAATTAAAATTTAAAAAAGG + Intergenic
1090167265 11:124562691-124562713 CCTGATGTAAAATTTTATACAGG + Intergenic
1090369706 11:126240423-126240445 CTTCTTTTGAAATTTAATACTGG + Intronic
1090468845 11:126960223-126960245 CCTCATTTCAAATTTAATCAAGG - Intronic
1090788773 11:130071112-130071134 GCTCTTTTAAAAATTACAACTGG + Intronic
1091332246 11:134738622-134738644 GCTCATTTTAATGTTGATACAGG - Intergenic
1093234352 12:16587918-16587940 GTTCATTTAAAATTAAATCAAGG - Intronic
1093247285 12:16755151-16755173 CCTTATTTAAAATTTAGAACTGG + Intergenic
1093326908 12:17787001-17787023 GCCAAATTAAAATTTATTACAGG + Intergenic
1093334432 12:17885085-17885107 ACTCATTTAAAAATAAATAAAGG - Intergenic
1093862634 12:24185709-24185731 GCTCATTTAATCTTTACAACAGG - Intergenic
1094695367 12:32812802-32812824 TCCCATTTAAAAGTTAATAATGG - Intronic
1095342638 12:41109923-41109945 ACTCATATAACATTTAAGACAGG - Intergenic
1097985831 12:65782417-65782439 TCTCATTTAAACTTCAATAATGG + Intergenic
1098775744 12:74613120-74613142 ACAAATTTAAAATATAATACAGG - Intergenic
1099007493 12:77251479-77251501 GATCATCTAAAATCCAATACAGG + Intergenic
1099654623 12:85473510-85473532 GCTCATTTAAACTTTGACAATGG + Intergenic
1100398920 12:94210617-94210639 GATGATTTAACATTTAATAAAGG + Intronic
1100524078 12:95403824-95403846 GCTCAATAAATATTTACTACAGG + Intergenic
1101235472 12:102784757-102784779 TCTCATTTAAAATTTGAGGCTGG + Intergenic
1101688591 12:107051305-107051327 GAATATTTAAAAATTAATACAGG - Intronic
1104541632 12:129671339-129671361 ACTCATTTTCAATTTAATATTGG - Intronic
1106648295 13:31660959-31660981 GCTCATCAAAAAGTTAATTCAGG - Intergenic
1107236920 13:38182153-38182175 GCACATTTAAAAAATAATATGGG + Intergenic
1107509036 13:41062595-41062617 GCTCATGTAAAACTTAAAAAAGG - Intronic
1109401587 13:61837164-61837186 ACTCAGTTAAATTTTATTACTGG - Intergenic
1109703485 13:66057921-66057943 GCTAATTTAAAATTGTTTACAGG - Intergenic
1109902208 13:68789006-68789028 GTTATTTTAAAAGTTAATACAGG - Intergenic
1109930434 13:69209657-69209679 TCTCATTTGATATTTAATATGGG - Intergenic
1111308206 13:86445094-86445116 TCTTTTTTAAAATTTTATACAGG + Intergenic
1111890775 13:94080144-94080166 GCTCTTCTAAAATTGAATCCTGG - Intronic
1113048304 13:106180700-106180722 GCTCATTCCAAATTTAATGGAGG - Intergenic
1114963746 14:27929467-27929489 GCTCATTTAAAATTTTTTATAGG + Intergenic
1115880777 14:37915197-37915219 GCTCTTTTAAAAAATAATAAGGG - Intronic
1116086792 14:40250541-40250563 GATCAATTGAAATTTATTACAGG - Intergenic
1116091210 14:40308998-40309020 GTTCATTTAAAAATTTATGCGGG - Intergenic
1118136555 14:63034216-63034238 ACACATTTAAAAAATAATACAGG - Intronic
1118529805 14:66691039-66691061 CCTCATTTAAAATTAAGTATAGG + Intronic
1119548000 14:75487215-75487237 TCTCATTTAAAACTCAATTCAGG + Intergenic
1121118891 14:91363678-91363700 GTTCATTTAAATTTAAAAACTGG - Intronic
1126588106 15:50310395-50310417 GCTGGTCTAAAATTTAAAACTGG + Intronic
1129436985 15:75549499-75549521 GCTAATTTCAAATTTAAAAAGGG + Intronic
1133676825 16:8081285-8081307 TCTCCTTTAAGATTTAACACAGG + Intergenic
1135187121 16:20324567-20324589 TCTCATTATAAATGTAATACAGG + Intronic
1138602789 16:58066692-58066714 ACTAATTTAAAATGTAAGACTGG - Intergenic
1138791892 16:59914626-59914648 GCTAATTTAAAATATACTATTGG - Intergenic
1139619589 16:68126912-68126934 GCTCATTTAAAATTTAATACAGG + Intronic
1140719899 16:77762126-77762148 GCACATTTCAAATGTAATAAGGG - Intergenic
1142536510 17:620527-620549 GCTCATTTGAAACTTACTCCAGG - Intronic
1144078758 17:11743255-11743277 GTTCATTTAAAATTATATATAGG - Intronic
1146556140 17:33825932-33825954 GTTCATTTAATTTTTAATTCAGG + Intronic
1147338181 17:39739321-39739343 GCTCTTTTAAAGTTTAATTCGGG - Intronic
1148637723 17:49161690-49161712 GCTAATTAAAAATTAACTACAGG - Intronic
1148917655 17:50996181-50996203 GTTCATTTAAAATTAAGTTCAGG - Intronic
1149241347 17:54653659-54653681 GCTCCTTTATAATTAAATTCAGG + Intergenic
1149468238 17:56896252-56896274 GCACATTTAAGATTTACTGCAGG + Intronic
1152275635 17:79355144-79355166 ACACATTTAACATTTAACACGGG + Intronic
1153332756 18:3890606-3890628 GTTTGTTTAAAATTTAAGACTGG - Intronic
1154322499 18:13366467-13366489 GCTCAGCTAAATTTAAATACTGG + Intronic
1155503168 18:26506863-26506885 GCTAATTTAAATTTTAATTTAGG + Intronic
1156983541 18:43322089-43322111 GCACATTTTAAAATTATTACTGG - Intergenic
1158821912 18:61169925-61169947 TCACATTTAATATTAAATACTGG - Intergenic
1159219110 18:65436843-65436865 TCTCATTTAAAATGTTATCCAGG - Intergenic
1159253803 18:65918830-65918852 CATCATTAAATATTTAATACTGG - Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1163114829 19:15182536-15182558 TCTCATTAACAATTTTATACTGG + Intronic
1164807912 19:31131183-31131205 TCTCATTTCATATTTAATATTGG - Intergenic
926664094 2:15500999-15501021 ACTCTTTTAAAAGATAATACTGG + Intronic
928279703 2:29934845-29934867 GCTGAGTAAAAATTTACTACTGG + Intergenic
928812919 2:35250663-35250685 GCTTATTTAAAAATAAATATAGG - Intergenic
930588031 2:53293167-53293189 GCTCATCTAAATATTAATAGGGG + Intergenic
930966343 2:57333262-57333284 CATTATTTAAAATTAAATACTGG + Intergenic
931876856 2:66522904-66522926 GCTCATGTAAAATTTAAGCTGGG + Intronic
932950367 2:76286256-76286278 CCTCATTTAAAATTACATAGTGG - Intergenic
932971298 2:76546245-76546267 GCTTATTTAATATTTAATATAGG - Intergenic
933826448 2:86165696-86165718 GATTTTTCAAAATTTAATACTGG - Intronic
934699181 2:96425025-96425047 GCTCATATTACATTTAATGCTGG - Intergenic
935294905 2:101640350-101640372 GCCCATCCAGAATTTAATACTGG - Intergenic
939217936 2:139263727-139263749 GCTCATTTAAACTCTAATAATGG + Intergenic
940329930 2:152463784-152463806 ACTCATTTCAAATTAAATCCTGG - Intronic
940412502 2:153381818-153381840 GCTGGTTCAATATTTAATACTGG - Intergenic
940416650 2:153430746-153430768 ACTCATTTAAAATTTTATAAAGG + Intergenic
940476781 2:154172015-154172037 GGTCAAGTAAAATTTATTACTGG - Intronic
941268611 2:163396508-163396530 GCACAGTTCAACTTTAATACTGG - Intergenic
941350175 2:164422218-164422240 TCACATTTAAAATTTAAAAGAGG - Intergenic
941381350 2:164796654-164796676 GCTCCTATAAAATTTAATGGTGG + Intronic
941418292 2:165249240-165249262 ATACACTTAAAATTTAATACTGG + Intronic
941878768 2:170461037-170461059 GCTCATTTATAATTTTCTATTGG - Intronic
941931420 2:170944033-170944055 GACCATTTAACATTTATTACTGG - Intronic
942156169 2:173130571-173130593 GTGCATTTAAAATCTAAAACTGG - Intronic
942531791 2:176918202-176918224 TCTTATTTAAAATTTACTATTGG - Intergenic
942700593 2:178704622-178704644 GCTTATTTCAAATTTATCACTGG + Exonic
943956256 2:194193979-194194001 ACTCATTTCAAATTTAATGAAGG + Intergenic
944447144 2:199803215-199803237 CCTCATTTAAAATTTCTTCCAGG - Intronic
944948187 2:204715220-204715242 TCACTTTTAAAATTTAATATGGG + Intronic
945450805 2:209992987-209993009 GCTCATTTAAAACTTATAGCTGG - Intronic
945500302 2:210564682-210564704 GCTCATTTTAAAAGTAATATAGG + Intronic
945926756 2:215813405-215813427 GCTTCTTTAAAAGTTAATATAGG - Intergenic
947171051 2:227311677-227311699 GCTATTTTGAAATTTATTACAGG - Intronic
947310620 2:228797844-228797866 GCTCATTGTAAATTAAAGACTGG + Intergenic
947337260 2:229100344-229100366 GCTAATTTAAAATTAAAAATAGG + Intronic
1168768702 20:399786-399808 GCCCATTAAAAATGTAATATCGG + Intergenic
1169736271 20:8840788-8840810 GCTGATTTCAAATTTAAAAAGGG - Intronic
1171047143 20:21820515-21820537 GGTCATTAAAAATTTAATAGTGG - Intergenic
1173695051 20:45003300-45003322 CCTGATTTAATATTTAATATTGG + Intronic
1174540066 20:51282224-51282246 ACTCTTTTAAAATTTAATCCTGG - Intergenic
1174648635 20:52105964-52105986 CCTCATTTAAAATTTAAATTTGG - Intronic
1177582632 21:23046618-23046640 GTTCATTTAAAAAATAAAACTGG + Intergenic
1177674778 21:24282496-24282518 TATAATTTAATATTTAATACTGG - Intergenic
1178359122 21:31933346-31933368 TCTCAGTTAAAAGTTAACACTGG + Intronic
1179203710 21:39252591-39252613 GCTCATGTGAAATTTTATAAAGG - Intronic
1181753460 22:25006330-25006352 GCTCATTTAAAATGTCATTAAGG - Intronic
949333107 3:2944231-2944253 GTTAATATAAAATTTAATAAAGG - Intronic
949479836 3:4483103-4483125 TCTCATTTAAAATGCAATAGAGG - Intergenic
949941463 3:9158112-9158134 GCTCTTTTACAATTTGTTACAGG - Intronic
950166057 3:10800120-10800142 GCCCATGTAAAAATTTATACAGG + Intergenic
950168392 3:10818480-10818502 GCTAATTTAAAGTTTCATATTGG - Intronic
952901864 3:38116273-38116295 TCTCATTTAAAATTTTAAAAAGG - Intronic
953285509 3:41603089-41603111 ACTCACTTAAAATATAATAAAGG + Intronic
954824432 3:53359961-53359983 TCTAATGTAATATTTAATACTGG + Intergenic
956499505 3:69866596-69866618 TCTCCTTTAAAATTGAATACTGG + Intronic
956857309 3:73287747-73287769 GCTCACTTAATATTTACTAAAGG - Intergenic
957646079 3:82929666-82929688 GCTAATTTAAATTGCAATACAGG - Intergenic
958426241 3:93980968-93980990 TCTCATTTAATATTTAAGAAAGG - Intronic
958603161 3:96325307-96325329 ACTTATTTATATTTTAATACAGG - Intergenic
959279376 3:104318202-104318224 GTTCATTCAAAAATTAATAATGG + Intergenic
960297137 3:115958040-115958062 GCTCATCTAAAAAATAAAACAGG - Intronic
960434841 3:117613378-117613400 TTACATTTAAAATTTAATTCAGG + Intergenic
960827066 3:121799322-121799344 CTTCATCTAAAATTGAATACAGG + Exonic
962953391 3:140242376-140242398 GCACATTTGAAATATAATATTGG + Intronic
963066768 3:141270449-141270471 GCACTTTTAAAATTCAGTACAGG + Intronic
963337728 3:143996475-143996497 GCTCATTAAAAATCAAATAATGG + Intronic
964562715 3:158015679-158015701 GCTCATTTATAATTTTATCATGG - Intergenic
964598089 3:158460072-158460094 GCTCATCCAAAGTTTAATGCTGG + Intronic
965482698 3:169239961-169239983 GCTCGTTTAGAATTAAAGACAGG - Intronic
965700130 3:171452227-171452249 GCTCATTTAAAAATTAGAAAGGG + Intronic
966965085 3:184983437-184983459 GATAATCTAAAAATTAATACAGG + Intronic
969039759 4:4286949-4286971 CATCATTTAAAATTTAATTAAGG - Intronic
969887947 4:10233154-10233176 ACACATTTAAAATTTACTAGAGG - Intergenic
970154734 4:13130586-13130608 GCTTATTAAAAGTTTACTACAGG + Intergenic
970506212 4:16733266-16733288 AGTCATTTAAAATTTAACCCTGG + Intronic
970572261 4:17394368-17394390 GCTCATTTAAAGCTTAAAAAGGG + Intergenic
970600187 4:17636063-17636085 ACTCACTAAAAAATTAATACAGG - Intronic
970620522 4:17812604-17812626 GGTCATTAAAAATTTAATGCTGG - Intronic
971594560 4:28512270-28512292 ACTCATTTAAAATTTTATAAAGG + Intergenic
971941622 4:33223241-33223263 GCTTTCTTAAAAGTTAATACAGG + Intergenic
971951540 4:33356113-33356135 GCACATTTAAAATGTAATTTAGG + Intergenic
973821722 4:54667536-54667558 ACTCTTTTAAGATTTAATTCAGG - Intronic
973895167 4:55404888-55404910 GCTGTTTTAAGTTTTAATACAGG - Intronic
974885087 4:67808813-67808835 GCTAATTTAAGAGTTAATTCTGG + Intergenic
975436053 4:74353085-74353107 GTTTATTTGAAAATTAATACAGG - Intergenic
975877440 4:78859173-78859195 GATCACTTAAAAATTAATACAGG + Intronic
976021586 4:80635223-80635245 GCTTATCTGGAATTTAATACAGG + Intronic
976588164 4:86822007-86822029 TCTCATTTAAAATTTCATTTAGG - Intergenic
976714056 4:88104477-88104499 GCTTATTTAAAAAATGATACTGG + Intronic
976801874 4:89002016-89002038 TCTCATTTAAAATCAAATATGGG + Intronic
978128740 4:105168164-105168186 GATCATTTAAAAATTAAGTCAGG + Intronic
978873564 4:113609884-113609906 GCTCATTGAAAATTTTAAAGTGG - Intronic
978877055 4:113653752-113653774 ACTCATTTATAAGTAAATACTGG + Intronic
979002889 4:115248174-115248196 GCACAGTTAAAATTCAATGCAGG + Intergenic
979166505 4:117539254-117539276 GTTCATGTAACATTTAATAGGGG + Intergenic
979737934 4:124111773-124111795 GTTCATTTTAAAGTAAATACAGG - Intergenic
979910676 4:126362148-126362170 GCTTATTTAAAATTCAATAGTGG - Intergenic
980190157 4:129514669-129514691 ACTAATTTAAAATTTAAAAGTGG - Intergenic
980678483 4:136123612-136123634 GCTCTTTAAAAATTTAGTAGAGG - Intergenic
980927317 4:139150683-139150705 GCAAATTGAAAACTTAATACAGG + Intronic
980963217 4:139497156-139497178 GCTCATTTAAAAATAAAGTCCGG + Intronic
980965742 4:139518974-139518996 GCACAATTACAATTTAATAGTGG - Intronic
981330389 4:143501533-143501555 TCTCAGGTAAAATTTAATATAGG + Intergenic
982061846 4:151612683-151612705 GGACATTTAAAAATTAATATGGG - Intronic
982976601 4:162069935-162069957 GCTCCTTTAAAAATTAGTATAGG - Intronic
983961068 4:173755306-173755328 GGTGATTTAAAAGTTAATATTGG + Intergenic
984000894 4:174242881-174242903 TTTCAATTAAAATTAAATACTGG - Intronic
986107644 5:4675273-4675295 AATCATGTAAAATATAATACTGG + Intergenic
986327040 5:6684033-6684055 ACATATTTAAAATATAATACAGG - Intergenic
986585180 5:9309080-9309102 GCATATTAAAAATTTAATCCTGG + Intronic
987162633 5:15160134-15160156 TCTGATCTAACATTTAATACTGG + Intergenic
987438569 5:17928370-17928392 TCTCATTTCAAAATTAAAACTGG + Intergenic
988067772 5:26243980-26244002 GCAAATTTCAAATTTAATTCTGG - Intergenic
988260361 5:28878899-28878921 GCTCATTTGAAAGTTGAGACAGG + Intergenic
988969407 5:36451114-36451136 GCTCATTAATAATTTCATATGGG + Intergenic
990025471 5:51182183-51182205 GCTCATCTAAAATTTACTAAAGG + Intergenic
990742794 5:58929369-58929391 ACTCATTTAAAAGTTCATAAGGG - Intergenic
990933511 5:61120761-61120783 TCTCATTTAAGTTTTAAAACTGG + Intronic
991075304 5:62529742-62529764 GCCTATTCAAAATCTAATACTGG - Intronic
991393801 5:66181851-66181873 GCTCAATTAAAAATAAACACTGG + Exonic
992234172 5:74692195-74692217 GCTGATTAAGAATTTGATACAGG + Intronic
993156907 5:84236946-84236968 TCTTTTTGAAAATTTAATACAGG + Intronic
993164279 5:84331746-84331768 ACTATTTTTAAATTTAATACTGG + Intronic
993611195 5:90056449-90056471 GCTCACTTAAAATCAAATAATGG - Intergenic
993858715 5:93107575-93107597 GCTAATTTAAAAATTAGCACAGG - Intergenic
994747460 5:103696508-103696530 GATCACTTAAAATTTAATAATGG + Intergenic
996410996 5:123158994-123159016 GCTCTTCTAAAGTTTGATACAGG - Intronic
997536614 5:134627496-134627518 GCTCATTTACTTTTTAAAACCGG + Intronic
998298438 5:140994391-140994413 GATTATTTGACATTTAATACTGG + Intronic
1000018471 5:157299184-157299206 ACTCTTTTAAAATATAATTCAGG + Intronic
1002332220 5:178451353-178451375 TCACATTAAAAAATTAATACAGG + Intronic
1002965255 6:1958941-1958963 TCTTACTTAAAACTTAATACTGG + Intronic
1003935304 6:10969898-10969920 ACTCATATAACATTTCATACAGG - Intronic
1004597440 6:17113766-17113788 GCTGATTAAAAAAGTAATACAGG - Intronic
1004606858 6:17203005-17203027 GCTCTTTTAAAATCTGAAACAGG + Intergenic
1005562829 6:27058878-27058900 GTTCCTGTAAAATTTAATGCTGG + Intergenic
1006761306 6:36464281-36464303 TTTCAGTTCAAATTTAATACTGG - Intronic
1007172543 6:39873925-39873947 GCTCATTTCAAATTGCATTCTGG - Intronic
1007436134 6:41812392-41812414 GCACATTAAAACTTTAGTACAGG + Intronic
1009033269 6:58086095-58086117 GGTAATTTAAGATTTAATAAGGG - Intergenic
1009208879 6:60837870-60837892 GGTAATTTAAGATTTAATAAGGG - Intergenic
1009398070 6:63225423-63225445 TCTCATTTAAAATTAAAAAATGG - Intergenic
1009773510 6:68175865-68175887 GCCAATTTAAAATATAACACAGG + Intergenic
1010086080 6:71919516-71919538 GGCAATTTAAAATTTAAGACTGG + Intronic
1012011504 6:93792381-93792403 ACTCATTAAAAAATAAATACAGG - Intergenic
1012087213 6:94843729-94843751 GCACATTCAAAATTTGATAGGGG + Intergenic
1012090609 6:94889704-94889726 GGGTATTTAAAATTCAATACTGG - Intergenic
1013026666 6:106280961-106280983 GCTCCTTTTAAATTTATTAAAGG - Intronic
1014367847 6:120566389-120566411 GAACATTGAAAATATAATACTGG - Intergenic
1014847003 6:126289593-126289615 CCTCATTTAAAATCTATAACAGG - Intergenic
1015428417 6:133100485-133100507 GGTTATTAAAAATGTAATACAGG + Intergenic
1015451288 6:133369759-133369781 GCTTTTTGAAAATTTAATGCAGG + Intronic
1015649498 6:135440080-135440102 GCTCCTTTAAAGTTTGAGACAGG - Intronic
1015699414 6:136019085-136019107 GCTTATTTAACATATAATCCTGG + Intronic
1017296473 6:152801441-152801463 GCTAATTTAGAATTTAATCCAGG + Intergenic
1018562381 6:165115337-165115359 TCTCATTTAAAATTAAATACTGG - Intergenic
1020644788 7:10801682-10801704 ACTCCTTGAAAATTTAATAAGGG - Intergenic
1020772622 7:12414473-12414495 GCTCATTTCAAATTGAATTAGGG - Intergenic
1021204087 7:17758556-17758578 GCTATTTTAAAAGCTAATACAGG + Intergenic
1022231987 7:28423274-28423296 GCTCAGTTAATATTTAATGAAGG - Intronic
1022331997 7:29388665-29388687 GCTCATTTGAAAGATAATTCAGG + Intronic
1023707045 7:42952073-42952095 GCTTCCTTAAAAGTTAATACAGG - Intergenic
1024315602 7:48013702-48013724 GCATATTTAAAATCTATTACTGG + Intronic
1024394462 7:48849655-48849677 GCTCATGTAAAATTTAATCTGGG + Intergenic
1024400804 7:48922986-48923008 GCTCATGTAAAATTTAATCTGGG - Intergenic
1028191631 7:87859892-87859914 GCTATTTTAAAACTTGATACAGG + Intronic
1028356576 7:89917466-89917488 GTGTATTTAAATTTTAATACTGG + Intergenic
1030214008 7:107024741-107024763 CCTCATATTATATTTAATACAGG + Intergenic
1030495092 7:110288891-110288913 GTTCTTTTAAAATTTTATAGTGG - Intergenic
1031250179 7:119370363-119370385 ATTCATTTAAAAATTAATGCAGG - Intergenic
1031385538 7:121146022-121146044 GTTTATTTAAAATTTAATAATGG - Intronic
1031842785 7:126766455-126766477 GCCCATTTAAAATTGAATAGTGG - Intronic
1032150533 7:129425652-129425674 GCTCTTTAAAAATTTAAGACAGG - Intronic
1036516585 8:9449960-9449982 CATCAGCTAAAATTTAATACGGG + Intergenic
1037261678 8:17016344-17016366 ACTCATTTAAATTCCAATACAGG + Intergenic
1037984615 8:23281276-23281298 GCTCATTTCAAATACAATATAGG - Intronic
1038264848 8:26030631-26030653 GCTCACTTAAAACCTGATACTGG + Intronic
1039829143 8:41199137-41199159 GCTCATTCTAAAGCTAATACAGG - Intergenic
1040381704 8:46879343-46879365 GCTCAGTTACCATTTCATACAGG + Intergenic
1041493785 8:58463991-58464013 GCTGATTTCAGATTTAAGACAGG + Intergenic
1041578089 8:59422512-59422534 GCTGATTTAAACATTAATCCAGG + Intergenic
1043684576 8:83069917-83069939 TCTCATATAACATTTAATATGGG - Intergenic
1044655843 8:94547559-94547581 GGTCATTTAAAAATTACTTCAGG - Intronic
1045739437 8:105338490-105338512 GCTTATTTAAAATATAGTAATGG + Intronic
1045849936 8:106682790-106682812 GATCATTTTGAGTTTAATACAGG + Intronic
1045968269 8:108051205-108051227 GCTCATCTAAATGTTAATATAGG + Intronic
1046095629 8:109556714-109556736 TCACTTTTAAAAATTAATACAGG - Intronic
1046226900 8:111293916-111293938 GCTTATACAAAATTTAATTCTGG - Intergenic
1048155770 8:131948864-131948886 GCTAATTTAAAATTTATTAATGG + Intronic
1050857662 9:10381131-10381153 GAGCATTTAAAAAATAATACAGG - Intronic
1050905688 9:11002063-11002085 ACTGATTAAAAATTCAATACAGG + Intergenic
1050970847 9:11871294-11871316 AGTCATTTATAATTTAATAAAGG + Intergenic
1052500519 9:29283531-29283553 TCTCATTGAAAATTGAATGCAGG - Intergenic
1203445447 Un_GL000219v1:50277-50299 TCTTTTTTAACATTTAATACTGG - Intergenic
1188682846 X:33032518-33032540 GCTTATTTTAAATTTAATGATGG - Intronic
1188734447 X:33695385-33695407 GTTGCTTTAAAGTTTAATACAGG - Intergenic
1189806514 X:44740987-44741009 CCTCATTTAAAATCTAACCCTGG + Intergenic
1190951023 X:55142936-55142958 TCTCATTTAAAATATATAACAGG + Intronic
1193149642 X:78111378-78111400 CTTCATTTAAAATTTAAAATAGG - Intronic
1193454899 X:81719528-81719550 ACTCATTTAGAATGTAAAACTGG + Intergenic
1194052276 X:89084755-89084777 GTTCATATAAATTTTAAAACTGG - Intergenic
1194609925 X:96030443-96030465 GCCCATATAAAGTTTAATATGGG + Intergenic
1195897068 X:109756801-109756823 GCTCATATCAAATTGAATAGGGG + Intergenic
1198283235 X:135163634-135163656 GATCATTTAAAAAATAATAATGG + Intronic
1198285553 X:135186902-135186924 GATTATTTAAAAATTAATAATGG + Intergenic
1199499116 X:148489834-148489856 ATTCATTTAAAAGGTAATACAGG + Intergenic
1200905179 Y:8474560-8474582 TCAAATTTAAAATTTAAAACGGG + Intergenic
1200925158 Y:8647694-8647716 GCTCATTTACAACATAAGACTGG + Intergenic