ID: 1139622172

View in Genome Browser
Species Human (GRCh38)
Location 16:68154403-68154425
Sequence GGGTGCTGAAAGTTTAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139622172 Original CRISPR GGGTGCTGAAAGTTTAAACT AGG (reversed) Intronic
905098920 1:35501242-35501264 GGATGGTGAAAATTCAAACTTGG - Intronic
907225281 1:52940503-52940525 TGGAGCTGAAAGTTTAGTCTAGG - Intronic
909286316 1:73824331-73824353 GGGTGTTGAATGGTTTAACTAGG - Intergenic
911872302 1:103113883-103113905 GGATACTTAAAGTTCAAACTAGG + Intergenic
915900690 1:159844620-159844642 GGGTGCTGCAATCTTAAACGAGG + Intronic
918189169 1:182155594-182155616 ATGTGCTGAAAGTATAAAATAGG - Intergenic
919099442 1:193076092-193076114 AGGTGCTAAAAGGATAAACTTGG + Intronic
1068672220 10:59734752-59734774 GGGAGCTGGAAGTTACAACTAGG - Intronic
1071020990 10:81056037-81056059 GGTAGCTGAAAGTGTAATCTGGG + Intergenic
1071528101 10:86369857-86369879 GGGTGCAAAAAGATAAAACTGGG + Intergenic
1074744157 10:116514933-116514955 GGGTGCTGAAATTTTATATTTGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1090947561 11:131445282-131445304 GGGTGCTGATAGTGTAAAGCTGG - Intronic
1095712624 12:45306840-45306862 GGGTGGTGACAGTTTTAAATAGG + Intronic
1099774517 12:87107888-87107910 AGGTGATGAAATTTTGAACTTGG + Intergenic
1100751443 12:97702561-97702583 GGGGCTTGAAAGTTTATACTAGG + Intergenic
1101437185 12:104673822-104673844 GGCTGCTGAAAGATTAAATGTGG + Intronic
1106226309 13:27789724-27789746 GGGTGACTAAAGTTCAAACTCGG + Intergenic
1106996170 13:35484341-35484363 GGTTGCAAAAAATTTAAACTTGG - Intronic
1110065873 13:71104614-71104636 AGGTGCTGAAAGTTGGAACAGGG - Intergenic
1110441528 13:75531756-75531778 TGTTGGTGAAAGTGTAAACTGGG + Intronic
1111078402 13:83268870-83268892 AGGTTCTGAAATTTCAAACTGGG + Intergenic
1112176769 13:97033500-97033522 ATGTACTGAAAGGTTAAACTAGG - Intergenic
1112845548 13:103638468-103638490 GGAGGATAAAAGTTTAAACTAGG + Intergenic
1114332401 14:21650683-21650705 AGGTGCTGACAGTTGAAAGTTGG + Intergenic
1116831218 14:49721830-49721852 GGGTGCAGAAAGCATAAAGTGGG - Intronic
1117192205 14:53304306-53304328 GGGGGCTGTAAGTCTAAAATGGG + Intergenic
1121914414 14:97823376-97823398 GTGTGCTGAAAGTATAAAATAGG + Intergenic
1122438409 14:101713762-101713784 CGGTGCTGCAAGATTATACTTGG - Intergenic
1202863040 14_GL000225v1_random:96109-96131 AGGTGCTGTAACTTTAATCTCGG + Intergenic
1126785041 15:52171279-52171301 TTGTGCTGAATGTTAAAACTGGG + Intronic
1130889165 15:88118788-88118810 AGGTGCAGAATGTCTAAACTGGG + Intronic
1133014323 16:2932329-2932351 GAGGGCTGAAAGTTGAACCTAGG - Intronic
1139622172 16:68154403-68154425 GGGTGCTGAAAGTTTAAACTAGG - Intronic
1141368859 16:83468893-83468915 GGGAGATCAAAGTTTACACTGGG - Intronic
1141486376 16:84343053-84343075 AGATGCTGAAAGTTTTACCTGGG + Intergenic
1147533432 17:41301618-41301640 GGTTGCTGAAAGGTTATTCTCGG + Intergenic
1147662573 17:42124760-42124782 GGGCCCTGAAACTTCAAACTTGG + Intronic
1148555295 17:48575436-48575458 GGGTGCTTAAAATATACACTGGG + Intronic
1149104612 17:52947223-52947245 AGTTGCTGAAAATTTTAACTGGG + Intergenic
1152875461 17:82784148-82784170 GGGTACTGAAAGTATTAAGTTGG - Intronic
1155708079 18:28840686-28840708 GGGTACTGAATATGTAAACTTGG - Intergenic
1166423117 19:42653550-42653572 GGGTCCTGAAAGTTTATCCTTGG + Intronic
1167848874 19:52187039-52187061 GGGTGCTGGAATTTGAACCTGGG - Intergenic
1168329254 19:55557027-55557049 GGGTGTTAAAAGTTAAAAATAGG - Intergenic
1168575650 19:57506417-57506439 TGTTGCTGAACGTTTGAACTGGG - Exonic
926827202 2:16917825-16917847 AGATGCTGCAAGTTTAAACAAGG - Intergenic
929791141 2:45024039-45024061 GGGTGCAGGGAGGTTAAACTAGG + Intergenic
932004295 2:67912617-67912639 GGGGGCTGTAAATTTAAATTGGG - Intergenic
935356911 2:102209808-102209830 GAGTGCTGATAGTCTCAACTTGG + Intronic
936343972 2:111661357-111661379 GGGTGCTGAAAGGATCAAATGGG - Intergenic
936675897 2:114713688-114713710 GGGTGCTAAAAGTACAAATTTGG + Intronic
940664942 2:156597337-156597359 GGATGCTGAAAAGTTAAAATTGG + Intronic
943513106 2:188850959-188850981 GGCTCCTGAATGTTTAAAGTGGG + Intergenic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
945018877 2:205551107-205551129 CGGTGCTGAAACTATTAACTTGG + Intronic
1170475685 20:16712215-16712237 GGATCCAGAAATTTTAAACTGGG + Intergenic
1177004307 21:15652645-15652667 GGGTGGTGAAAGTTTGAGCAGGG - Intergenic
1178954660 21:37011368-37011390 GTGTGCTGAATGTTTTAACAGGG + Intronic
1183914097 22:41102813-41102835 AGTTGCTCAAACTTTAAACTGGG - Intronic
951858861 3:27228184-27228206 GGGAAGTGAAAATTTAAACTTGG - Intronic
954460538 3:50624334-50624356 AGGTGCTGAATGTCTAAACCAGG - Intronic
955616897 3:60818941-60818963 GGGAGCTGAAATTCAAAACTTGG - Intronic
957539724 3:81551933-81551955 TGGTGCTGAATGTTAGAACTAGG + Intronic
958497828 3:94867090-94867112 GGGTATTGAAGGTTGAAACTGGG - Intergenic
960969589 3:123130131-123130153 GTTTGCTGAAAGTTTGAAATAGG + Intronic
963471171 3:145743730-145743752 GGCTACAGAAAGTTTATACTAGG - Intergenic
964467618 3:157014076-157014098 GGATGCTGAACCTTTAAAATTGG + Intronic
965243863 3:166240376-166240398 GGTGGATGAAAGTTTATACTTGG - Intergenic
966308513 3:178565720-178565742 GGATGCTGAAGATTTAAATTTGG - Intronic
966645212 3:182238522-182238544 CTGTGCTGAGAATTTAAACTCGG + Intergenic
967793346 3:193572403-193572425 GACTGCTGTAAGTTTAAAATAGG - Intronic
969992121 4:11275449-11275471 GGGTGCAGAAAATTTATCCTGGG - Intergenic
971412871 4:26393802-26393824 GGGTGCAGAGAGTTTAAAATTGG + Intronic
976649088 4:87416121-87416143 GGGAGGTGAAAGTTAAAACTAGG + Intergenic
977990494 4:103435273-103435295 GGGTGCTGAAAATGAAATCTTGG - Intergenic
978568618 4:110112128-110112150 GGGTACTGAAAGTCTGAGCTGGG + Intronic
980145345 4:128976583-128976605 TTGAGCTGAAAGTTTAAATTGGG - Intronic
980145469 4:128978296-128978318 TAGGGCTGAAAGTTTAAATTGGG + Intronic
980855866 4:138438917-138438939 GAGAGCTGAAAGCTTAAACCTGG + Intergenic
984175487 4:176411727-176411749 GGGCTATGAAAGTTTAAACGTGG - Intergenic
985572021 5:652017-652039 GGGTCCTGAAAGATGAGACTGGG + Intronic
986657937 5:10033719-10033741 GTGTGCTGACATTTTAAAGTAGG + Intergenic
989035487 5:37167400-37167422 AAGTGCTGAAAGTTTCAAATGGG + Intronic
991272926 5:64807329-64807351 GAGTGCTTAATATTTAAACTGGG + Intronic
992049968 5:72932871-72932893 GGGTGTTCAAAGTTTAACTTGGG - Intergenic
994681512 5:102893674-102893696 GTGTGCTGAAAGGGTAAATTAGG + Intronic
996212244 5:120825614-120825636 GGGGGCTGATAGTTTAAAATTGG - Intergenic
996826853 5:127692581-127692603 AAGTGCTGAAAGTTCATACTAGG - Intergenic
1000271765 5:159691803-159691825 AGGTGCTGAGAGTATATACTGGG + Intergenic
1003107316 6:3226831-3226853 AGGTTCAGAAAGTTGAAACTGGG + Intronic
1003720674 6:8698311-8698333 GGGTGCTGAGAATATAAAATGGG - Intergenic
1006777751 6:36609267-36609289 TGGAGCTGAAACTATAAACTTGG + Intergenic
1007429104 6:41766490-41766512 GGGTGCTGAACTTTGAAAGTTGG - Intergenic
1014294384 6:119600892-119600914 GGCTGCTGAACTTTTACACTGGG + Intergenic
1016033317 6:139359904-139359926 GTGTGATGAATGTTTCAACTGGG + Intergenic
1017954320 6:159166304-159166326 GGGTTCTGAAACTCTAAAATTGG + Intergenic
1018504162 6:164445818-164445840 GGGTGGCCACAGTTTAAACTGGG + Intergenic
1018524064 6:164687728-164687750 GGGTGCTGTAACTTTAAAAAAGG + Intergenic
1019767015 7:2858945-2858967 AGGTGCTGACATTTTAATCTTGG - Intergenic
1023331031 7:39117213-39117235 GGTTGCTGAAAGCTTCAGCTTGG + Intronic
1023694675 7:42832709-42832731 GTGTGCTCAAATTTAAAACTAGG + Intergenic
1027307792 7:76920008-76920030 GGGTGCAGACAGCCTAAACTTGG - Intergenic
1027960613 7:84940957-84940979 GACTGCTGAATGTTCAAACTGGG + Intergenic
1028216205 7:88136647-88136669 AGATGGTCAAAGTTTAAACTAGG - Intronic
1028216224 7:88136859-88136881 AGATGGTAAAAGTTTAAACTAGG + Intronic
1029922781 7:104283363-104283385 GGGTGTTGAAAATGTAAGCTTGG - Intergenic
1030203049 7:106925272-106925294 AGATTCTGGAAGTTTAAACTAGG - Intergenic
1034235417 7:149564518-149564540 AGGTGCTGACAGTTGAAATTGGG - Intergenic
1035810627 8:2488309-2488331 GGGAGGTGAAAGTTTAGACCTGG - Intergenic
1036991571 8:13603626-13603648 GGGTCTTGAACGTTTATACTGGG - Intergenic
1047670072 8:127136452-127136474 TGGTTCTGAAAGTTTATTCTGGG - Intergenic
1048371169 8:133777424-133777446 GGCTGGTGGAAGTGTAAACTGGG + Intergenic
1051340287 9:16104172-16104194 GGGAGGTGAAAGTTGAAAGTGGG - Intergenic
1058527219 9:105871804-105871826 GTGTGCTGTGGGTTTAAACTAGG - Intergenic
1060053536 9:120393672-120393694 GAGTGCTGAGGGTTTAAACCAGG + Intronic
1060374506 9:123106411-123106433 GGGTGATGAGAGATGAAACTGGG + Intergenic
1061479988 9:130892958-130892980 TGGTTCTGAAAGTTAAAAATGGG - Intergenic
1186401996 X:9268823-9268845 GGATGATGAAAGTTTAGACAAGG + Intergenic
1187394554 X:18908086-18908108 TGGTCCAGAAAGTTTAGACTGGG + Intronic
1195309164 X:103614103-103614125 GGGTGATGAAAATGTAAAATTGG + Intronic
1197274508 X:124462489-124462511 GGTTGCTGAATGTTAATACTCGG - Intronic