ID: 1139624870

View in Genome Browser
Species Human (GRCh38)
Location 16:68179204-68179226
Sequence CAGGGTCTTCAACCTAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139624870_1139624871 -7 Left 1139624870 16:68179204-68179226 CCAAGATTAGGTTGAAGACCCTG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1139624871 16:68179220-68179242 GACCCTGATCCCTGTGTTCTTGG 0: 1
1: 0
2: 2
3: 32
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139624870 Original CRISPR CAGGGTCTTCAACCTAATCT TGG (reversed) Intronic
901572772 1:10175059-10175081 ATGGGTCTTCAGCCTACTCTTGG - Intronic
907393269 1:54172550-54172572 CAGGGGCTTTAGCCTAGTCTAGG - Intronic
912691727 1:111809815-111809837 CAGGGTCCCCAACCTGCTCTGGG + Intronic
912740052 1:112186232-112186254 CAGGGTCTCCAGCCCAAGCTCGG - Intergenic
914425427 1:147571556-147571578 AAGGGACTTCAACATAACCTGGG - Intronic
917236478 1:172897988-172898010 TAGGGTCTTCAACCTTAACTTGG + Intergenic
919135952 1:193507982-193508004 CAGGGATTACTACCTAATCTGGG + Intergenic
1069508573 10:69023112-69023134 GAAGGTCTCCAACATAATCTGGG - Intergenic
1076319536 10:129567528-129567550 CAGGATTTTCAACCTACTGTTGG - Intronic
1077786344 11:5388371-5388393 GAGGGTATTCAAACTAAACTTGG + Intronic
1078993846 11:16676526-16676548 CAGAATCTTCAACCTTCTCTGGG + Intronic
1079115398 11:17637668-17637690 TACGGTCATCACCCTAATCTGGG - Intronic
1082728333 11:56764382-56764404 CATGCTCTTCAACATAATCAGGG - Intergenic
1085901095 11:80700418-80700440 CTGGGTTTTCAACCCAAACTTGG - Intergenic
1085984546 11:81769854-81769876 CTGGGTATTCAACCAACTCTGGG + Intergenic
1089066082 11:115662929-115662951 CAGTGTATGCAACCTAAGCTGGG - Intergenic
1094125768 12:27021238-27021260 CAGGGTCAACACCCTATTCTAGG + Intergenic
1098764106 12:74462910-74462932 AAGGATTTTCAACCTAATCATGG + Intergenic
1108292154 13:48972752-48972774 CATGGTCTTTATCCTAATGTGGG + Intergenic
1111379575 13:87430202-87430224 CAGGGTATTCAACCTAGTTGAGG - Intergenic
1114707329 14:24740455-24740477 CAGGGTCTTCAGGCCAATCTGGG + Intergenic
1119047076 14:71328242-71328264 CAGGAACCTCAGCCTAATCTGGG + Intronic
1119677293 14:76565512-76565534 CAGGGGCTTCATCCTCGTCTAGG - Intergenic
1119677583 14:76567238-76567260 CAGGGGCTTCATCCTCGTCTAGG + Intergenic
1202903807 14_GL000194v1_random:57337-57359 CAGGGTCTTCCTCCTGCTCTTGG - Intergenic
1124541262 15:30587842-30587864 AAGGGTCCTTAACCTAGTCTGGG + Intergenic
1126652966 15:50944656-50944678 CAGTATCTTCATCCTCATCTTGG - Intronic
1129853528 15:78809444-78809466 CACTCTCTCCAACCTAATCTGGG - Intronic
1130579028 15:85118257-85118279 CAGGGTTATCTACCTAATCCAGG + Intronic
1135077348 16:19404919-19404941 CAGGATCTCCAACTTTATCTTGG - Intergenic
1138593443 16:58016141-58016163 CATGGCCATCACCCTAATCTAGG - Intronic
1139624870 16:68179204-68179226 CAGGGTCTTCAACCTAATCTTGG - Intronic
1143185576 17:5008085-5008107 CAGGCTCTTCAACCTCATGTTGG - Intronic
1149797893 17:59538265-59538287 CAGGGCACTCAGCCTAATCTGGG - Intergenic
1151225996 17:72648790-72648812 AAGGTTCTCCAACCTGATCTGGG + Exonic
1151557571 17:74854378-74854400 CTGGGTCTTCACCCTGACCTAGG + Intronic
1153052946 18:917395-917417 CAGGGTCATTAAACTGATCTGGG - Intergenic
1156347964 18:36274875-36274897 CAGGGTCTGCAAACAAACCTGGG + Intergenic
1156636580 18:39037964-39037986 CAGTATCTTCAAACTATTCTAGG - Intergenic
1156693692 18:39740102-39740124 CATTGTCCTCACCCTAATCTAGG + Intergenic
1163887800 19:19983453-19983475 CTGGATCTTCAGCCTCATCTTGG + Intergenic
1164854031 19:31506972-31506994 CAGGGTCTTCCACCTCTTCCGGG - Intergenic
1164854047 19:31507038-31507060 CAGGGTCTTCCACCTCTTCCTGG - Intergenic
1164854062 19:31507104-31507126 CAGGGTCTTCCACCTCTTCCTGG - Intergenic
1164854077 19:31507170-31507192 CAGGGTCTTCCACCTCTTCCTGG - Intergenic
1164854092 19:31507236-31507258 CAGGGTCTTCCACCTCTTCCTGG - Intergenic
1164854107 19:31507302-31507324 CAGGGTCTTCCACCTCTTCCTGG - Intergenic
1164854122 19:31507368-31507390 CAGGGTCTTCCACCTCTTCCTGG - Intergenic
1164854136 19:31507433-31507455 CAGGGTCTTCCACCTCTTCCGGG - Intergenic
1167898017 19:52597685-52597707 CAGGGCCTTGAACAGAATCTGGG + Intronic
929475370 2:42241783-42241805 CAAGGTCACCAAACTAATCTAGG - Intronic
930759955 2:55023017-55023039 TTGGTTCTTAAACCTAATCTGGG + Intronic
932343499 2:70981091-70981113 CAGTGTCTTCAACTGAAACTTGG + Intronic
933353306 2:81183477-81183499 CAATGCCTTCAACCTAACCTCGG + Intergenic
946819857 2:223618565-223618587 AAGGGTCTTTAAGCTGATCTGGG - Intergenic
1172600831 20:36181820-36181842 CTTGGTCTACAACCTAGTCTGGG - Intronic
1174547100 20:51333875-51333897 CAAGGTTTGGAACCTAATCTTGG - Intergenic
1175871566 20:62211754-62211776 CAGGGGCTTCATCCCAAGCTGGG + Intergenic
1176623176 21:9072105-9072127 CAGGGTCTTCCTCCTGTTCTTGG - Intergenic
1183863435 22:40685351-40685373 CAGGGTCTTCACCCGCTTCTTGG - Intergenic
951198780 3:19854867-19854889 AAGGGTCTCCAACTTAATCCAGG - Intergenic
953476833 3:43212409-43212431 CAGGGTCTGAAACCTTATCAGGG - Intergenic
955229841 3:57089022-57089044 CAGGGCCTACAACCTACTCTGGG - Intergenic
955623473 3:60891347-60891369 CAGGGTGATCAACCTGATCTGGG - Intronic
962709046 3:138070210-138070232 CAGGGCCTTCCACCTCACCTGGG - Intronic
967689849 3:192461402-192461424 TAGGGTATTTAACCTAATTTGGG - Intronic
969015564 4:4101994-4102016 CAGGGTCTCCAGCCCAAACTTGG + Intergenic
970440640 4:16078397-16078419 CAGGGCCTTCAGCCTAATCCAGG + Intronic
972107343 4:35506021-35506043 CAGGGGCTTCAACTTAATTAGGG + Intergenic
973337883 4:48974835-48974857 CAGAGTTTTCATTCTAATCTTGG + Intergenic
977466735 4:97391475-97391497 TAGTGTCTTCAAGATAATCTTGG - Intronic
981229814 4:142339530-142339552 TGGGGTCTACAACCTAATCCTGG - Intronic
989127607 5:38072270-38072292 CATGGTCTTTCACTTAATCTTGG + Intergenic
992553498 5:77881435-77881457 CAGGGCCTTCATCCTAATACTGG + Intergenic
995884060 5:116873538-116873560 CAGATTTTTCAACCTAATATAGG + Intergenic
996129422 5:119763828-119763850 CATGGTCTTCATCCTATTCTTGG - Intergenic
997715473 5:136039535-136039557 CAGGGTCATCAACCTTCTCCAGG + Intronic
999623912 5:153500159-153500181 CAGGATCTTCAAACTAGTCAGGG - Intronic
1002345723 5:178546484-178546506 CAGGGTCTGCACCCTCATCCTGG - Intronic
1003437971 6:6111551-6111573 CAAGGTCTTCAATGTAACCTAGG + Intergenic
1010128188 6:72459660-72459682 CAGGGAGTCCAACCTAAACTTGG - Intergenic
1013221772 6:108083953-108083975 CAGAGTCATCTACCTACTCTAGG + Intronic
1014820296 6:125981883-125981905 CAGGGTCTTCAATCAGATTTTGG - Intergenic
1017345423 6:153373812-153373834 CATGGTCTTGACCCTAATATGGG - Intergenic
1018588567 6:165390237-165390259 CAGTGTCTTCAATCGAATCCCGG - Intronic
1020736565 7:11956713-11956735 CAGGGTCTTAAACTTGAACTTGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1034716887 7:153251706-153251728 CAGGATCTTCACTCTGATCTGGG + Intergenic
1036673662 8:10811221-10811243 CACAGTCTTCAAACTACTCTTGG + Intronic
1045140971 8:99281843-99281865 CAGGGTCAATAACATAATCTTGG - Intronic
1048633275 8:136267923-136267945 CTGGGTCATAAACCCAATCTAGG - Intergenic
1052069032 9:24058588-24058610 CAGGGTATTAAACCAAATATAGG + Intergenic
1059559811 9:115323329-115323351 CATGGTCCTCAACCTTAACTAGG - Intronic
1059859242 9:118439564-118439586 CAGGGATTTAAACCTAATCATGG + Intergenic
1060422060 9:123476317-123476339 CTGGGCCTTAAACCAAATCTGGG - Intronic
1061324616 9:129856027-129856049 TAGTGTCTATAACCTAATCTTGG - Intronic
1203563744 Un_KI270744v1:76948-76970 CAGGGTCTTCCTCCTGTTCTTGG + Intergenic
1188952406 X:36392496-36392518 CAAAGTCTTCAACCAAATCATGG - Intergenic
1193772427 X:85603924-85603946 CATGGTCTTCAACTTTAACTGGG - Intergenic
1194476997 X:94370223-94370245 GATGGTCTTCAACAAAATCTGGG - Intergenic
1198439743 X:136651539-136651561 CAGGTTCTTTACACTAATCTAGG + Intronic
1200898487 Y:8402915-8402937 CAGGGACTCCAACTTTATCTTGG + Intergenic