ID: 1139629001

View in Genome Browser
Species Human (GRCh38)
Location 16:68216026-68216048
Sequence GCACTTAATATGTGTAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139629001_1139629005 -4 Left 1139629001 16:68216026-68216048 CCAGATTTACACATATTAAGTGC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1139629005 16:68216045-68216067 GTGCTGATGAGAAGGATCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 244
1139629001_1139629004 -5 Left 1139629001 16:68216026-68216048 CCAGATTTACACATATTAAGTGC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1139629004 16:68216044-68216066 AGTGCTGATGAGAAGGATCTGGG 0: 1
1: 0
2: 4
3: 33
4: 321
1139629001_1139629003 -6 Left 1139629001 16:68216026-68216048 CCAGATTTACACATATTAAGTGC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1139629003 16:68216043-68216065 AAGTGCTGATGAGAAGGATCTGG 0: 1
1: 0
2: 4
3: 24
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139629001 Original CRISPR GCACTTAATATGTGTAAATC TGG (reversed) Intronic
902906424 1:19561331-19561353 GTCTTTAATATCTGTAAATCAGG - Intergenic
904106918 1:28092613-28092635 GTACTTCATATATGTCAATCAGG - Intergenic
904649372 1:31993115-31993137 GCAGTTACTATGTGCAAATTAGG - Intergenic
905328979 1:37178916-37178938 GCACTTAAGATGTGGAAGTGTGG + Intergenic
906265684 1:44427342-44427364 GCACTTCATATATGTATGTCAGG + Intronic
909657623 1:78048352-78048374 CCACTTGCTATGTGTAATTCTGG - Intronic
910462822 1:87466942-87466964 ACACTTTATATGTGGAAGTCAGG - Intergenic
910482785 1:87676550-87676572 GCACACTATATGTGTACATCAGG + Intergenic
913169391 1:116218673-116218695 GCACTTGCTATGTGTCAGTCTGG + Intergenic
919633077 1:199977831-199977853 TTACTTTGTATGTGTAAATCTGG + Intergenic
921465525 1:215482575-215482597 GCACTTACTATGTGTGAACCAGG - Intergenic
922053137 1:222014040-222014062 GGGCTAAATATGTGTAAATTGGG - Intergenic
923707628 1:236357621-236357643 GCACTTAACATGAGGAAAGCAGG + Intronic
1064254959 10:13735525-13735547 GCACTTGATGTATGTAAAACAGG - Intronic
1065473816 10:26112168-26112190 GCATTGAATATGTTTAAATTTGG - Intronic
1065524548 10:26606308-26606330 GCACTGAATAAGAGGAAATCTGG + Intergenic
1070914966 10:80147690-80147712 TCATTTAATATATGAAAATCAGG - Intergenic
1072073733 10:91947141-91947163 GTAGAAAATATGTGTAAATCAGG - Intronic
1072400810 10:95097711-95097733 GCAAATAATATTTGTAAATTGGG + Intergenic
1074741290 10:116486673-116486695 GCAGTTAATTTGTTTAAATTGGG + Intergenic
1075890266 10:125943214-125943236 ACTCTTCATATGTCTAAATCAGG + Intronic
1079872222 11:25813716-25813738 GGACTTAATATGAATAACTCTGG + Intergenic
1085134746 11:74076217-74076239 GGACCTAACAGGTGTAAATCTGG - Intronic
1087115833 11:94523178-94523200 GCAGGTAATATGAGTAAAGCTGG - Intergenic
1094241837 12:28236705-28236727 CCACGTAAAATGTGAAAATCGGG + Intronic
1100392265 12:94154017-94154039 GCATATAATATGTGTATATGAGG - Intronic
1101238756 12:102816571-102816593 GCACTTTATAAGTGTTAATTTGG + Intergenic
1105550861 13:21394723-21394745 GCACTAAATCTGTTTAAATAAGG + Intronic
1105617846 13:22036608-22036630 GCACTTTATATGTGCACATGGGG - Intergenic
1106849048 13:33768863-33768885 GCACTAAAGATGTGTACACCTGG + Intergenic
1110026356 13:70544928-70544950 GCAACTGGTATGTGTAAATCAGG - Intergenic
1111675335 13:91380180-91380202 GTACTTAGTATGTTTAAAACTGG - Intergenic
1113418754 13:110153396-110153418 GCCCATAATTTGTCTAAATCAGG - Intronic
1115114000 14:29857704-29857726 GCACTTTTTATGAGTAAAGCAGG + Intronic
1117211318 14:53503420-53503442 GGACTTAATATGTATAAAAAGGG - Intergenic
1117262647 14:54052084-54052106 TCACTCAATTTGTGTATATCAGG + Intergenic
1118364131 14:65079727-65079749 GGATTTAATATGAGTAGATCTGG - Intronic
1119073611 14:71613264-71613286 GCAGTTAATATGTTTAAATCTGG + Intronic
1120644725 14:87059906-87059928 ACACTTAATATGCTTAATTCAGG + Intergenic
1120685759 14:87534888-87534910 ACACTTAAAATGTGTTAATTGGG + Intergenic
1124081598 15:26503773-26503795 GCACTTAATCTTTATAAATATGG + Intergenic
1126271567 15:46825087-46825109 TTACTTAAAATGTGTATATCAGG - Intergenic
1131983585 15:98018811-98018833 GCACTTGATAGGTGTAAAATGGG + Intergenic
1135567762 16:23524943-23524965 TTACTTAATATGGGAAAATCAGG - Intronic
1136546212 16:30956626-30956648 GCTCCTGATATGTGTACATCAGG - Intergenic
1138823223 16:60286764-60286786 GCATTTAATATATGTAATTAGGG - Intergenic
1139629001 16:68216026-68216048 GCACTTAATATGTGTAAATCTGG - Intronic
1142737318 17:1909081-1909103 GCAGTTCATATGTTTTAATCTGG - Intergenic
1147221844 17:38938732-38938754 GCGCTTTATATGTCTAAATCAGG - Exonic
1153571497 18:6477769-6477791 GCACTTACTATGTGTAAAATAGG - Intergenic
1153743409 18:8152120-8152142 GAACTTAAAATGTGCAAAGCTGG - Intronic
1156567297 18:38207316-38207338 GGACAAAATATGTGTAAAACAGG - Intergenic
1157794578 18:50561376-50561398 GCACCTACTATGTGAAAAGCAGG + Intronic
1158244871 18:55420746-55420768 GCTTCTAATATGTGTAAATGAGG - Intronic
1158372548 18:56825411-56825433 GTACTTAATATGTGTCAGACTGG + Intronic
1164278132 19:23741855-23741877 GTACATAGTATGTGTAAATATGG - Exonic
1165000018 19:32753284-32753306 GCTCTTAATATGTGTACAGATGG - Intronic
925101282 2:1248314-1248336 CCACGTAAGTTGTGTAAATCAGG - Intronic
926111409 2:10186712-10186734 GCACTTACTATGTGCTAAGCAGG - Intronic
929914366 2:46121893-46121915 GAACTTAAAAGGAGTAAATCAGG + Intronic
931065044 2:58576488-58576510 GCAATGAGTATGTGTAAGTCAGG - Intergenic
939554586 2:143659217-143659239 GCACTTAAAATTTGTAAGTAGGG + Intronic
940511751 2:154624398-154624420 ACAGTTAATATGTGAAAGTCAGG - Intergenic
943404925 2:187470211-187470233 GCAGATAATATGTGTGAATGTGG + Intronic
943751864 2:191517556-191517578 GCACTTAATAGGTGTCACTTTGG + Intergenic
944710424 2:202330327-202330349 CCATTTAATATATGTAGATCTGG - Intergenic
945188531 2:207164370-207164392 ACACTTCCTATGTGCAAATCCGG + Intronic
945444172 2:209915988-209916010 GCACTTAATATTTGTACACATGG - Intronic
948596632 2:239083547-239083569 ACACTAAATATGTATATATCTGG + Intronic
1169753805 20:9022775-9022797 GCATTTATTATGTCCAAATCTGG - Intergenic
1172859558 20:38036792-38036814 GCACTTAAAATGTGTGACTAAGG + Intronic
1177014624 21:15770714-15770736 GCACTTTAAATGTTTAATTCTGG + Intronic
1177305471 21:19309873-19309895 GTACTTAATAAATGTAACTCAGG + Intergenic
949691118 3:6640596-6640618 ACACTTAAAAAGTGAAAATCAGG - Intergenic
952604200 3:35124610-35124632 CAACTGAATATGTGGAAATCTGG + Intergenic
957827345 3:85465493-85465515 GTACTTAATATATATAAATTTGG - Intronic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
961083438 3:124045662-124045684 GCACTTAGTAGGTGTACAGCTGG - Intergenic
962414783 3:135172332-135172354 GCACTTACAATGAATAAATCTGG - Intronic
962506703 3:136053578-136053600 GCACTTTATATTTGTGAACCAGG - Intronic
962824758 3:139090281-139090303 GCACTTAAAATGTGTCCATTGGG + Intronic
966052906 3:175643087-175643109 GCATTAAATATATGTAAACCTGG + Intronic
967459872 3:189733198-189733220 GAACTTACTATGTGGAAATAAGG + Intronic
968246882 3:197159580-197159602 TCACTTAATATGTTGAAATTGGG + Intronic
969554244 4:7895487-7895509 GCACTTACTATGTGTTATGCTGG - Intronic
974457280 4:62144631-62144653 GCACTTAATATGACGAAAGCAGG - Intergenic
976521321 4:86030726-86030748 GGAATTAATAAGTGTAAATTAGG - Intronic
976570218 4:86598467-86598489 GAAATTAATATGTGCAAATGTGG + Intronic
978413764 4:108454291-108454313 GCAATTAATATGTGTAGAGATGG + Intergenic
979514167 4:121587854-121587876 GCAATAAATTTGTGGAAATCAGG - Intergenic
980662427 4:135880723-135880745 ACACTTAAGATGTCTACATCAGG + Intergenic
982957512 4:161791129-161791151 GCACTTAATTTGTGAAAAGATGG + Intronic
984084568 4:175292988-175293010 GCACTTATTATTTCTAAATCTGG + Intergenic
986360552 5:6974337-6974359 GCAGTTACTATGTGTTAAGCTGG + Intergenic
988735282 5:34014235-34014257 GAACTTATAATGTATAAATCTGG + Intronic
990571579 5:57084464-57084486 AGACTTAATATGTTTAAATGTGG + Intergenic
992697385 5:79303476-79303498 GTATTTAATATTTGTAATTCAGG + Intronic
992919434 5:81499073-81499095 GGAATTAAAATGTGTTAATCAGG - Intronic
998999010 5:147899290-147899312 GCACTTAACATGTACAAAGCAGG - Intronic
999762847 5:154716001-154716023 GGTCTTTATATGTCTAAATCTGG + Intronic
1000756505 5:165167682-165167704 ATACATTATATGTGTAAATCTGG + Intergenic
1008224204 6:48892432-48892454 GCCCTTAATATGATTACATCAGG - Intergenic
1009964271 6:70562314-70562336 GCATTTTAAATGTGTAAATATGG - Intergenic
1010138076 6:72578420-72578442 ACATTTCACATGTGTAAATCTGG - Intergenic
1012111274 6:95237937-95237959 GCACTTAAAATGTTTATAGCAGG - Intergenic
1014549017 6:122767254-122767276 GCCCTTAATATATGTATATATGG - Intergenic
1015596011 6:134867801-134867823 GCAATAAATATATGTAAATTTGG + Intergenic
1016106894 6:140174134-140174156 GCTCTAAAAATGTGTAACTCAGG - Intergenic
1016400371 6:143673497-143673519 GCAATTATTTTGTGTAAATTGGG + Intronic
1022998341 7:35782213-35782235 GCACTTAATATCTGCAAAGTAGG + Intergenic
1029065869 7:97847672-97847694 GTATTTAATATGTGTAAAATGGG + Intergenic
1029329285 7:99838199-99838221 ACACTTATTATGTGTTAAGCTGG + Intronic
1030330863 7:108268900-108268922 GAAGTTAATATTTGTAAAGCAGG - Intronic
1031448837 7:121888961-121888983 GGACTTAATTTGGATAAATCAGG + Intronic
1031797102 7:126188423-126188445 GCACTTAAAATTTGTTAATAGGG - Intergenic
1038775320 8:30525443-30525465 GCACTTAACATATATAAATAGGG - Intronic
1040981160 8:53247463-53247485 ACACTTAATATGTGTCAAGCAGG - Intronic
1041595820 8:59650307-59650329 GCACTGAAAATGTGTAAAATTGG + Intergenic
1042463663 8:69101360-69101382 GACCTTATTATGTGTAATTCTGG - Intergenic
1042743019 8:72072588-72072610 TTACTGAATATGTGTAAATTTGG - Intronic
1042758763 8:72248407-72248429 TTACTGAATATGTGTAAATTTGG - Intergenic
1045807117 8:106175972-106175994 GCACTTAATCTATTTAAATATGG + Intergenic
1046306605 8:112375539-112375561 GCACCTATTATGTGTTAATTAGG + Intronic
1046484137 8:114863191-114863213 GAACTTAATGTGTATAAATTTGG + Intergenic
1046850146 8:118962945-118962967 GCACTGGATATGAGTAAATCTGG + Intergenic
1055589287 9:77793808-77793830 AAACTTAATAGGTGTAAATGTGG - Intronic
1055874615 9:80927087-80927109 GCATTCAATATGTGAAATTCAGG - Intergenic
1056341952 9:85644036-85644058 GTAGTTAATATGTGTAAGTATGG - Intronic
1059203062 9:112436444-112436466 GCACTTACTATATGTAAGTCAGG - Intronic
1060975338 9:127761859-127761881 GCATTTCGTATCTGTAAATCAGG + Intronic
1185983020 X:4800276-4800298 TCATTTGATATGTGTAATTCTGG + Intergenic
1186201801 X:7162744-7162766 GCATTTAAAATGTGTAAGACTGG + Intergenic
1186447190 X:9641199-9641221 GAGATTACTATGTGTAAATCTGG + Intronic
1188536512 X:31202502-31202524 GAACTTATTATGTGTGCATCCGG + Intronic
1189906139 X:45761803-45761825 GCACTTAATATCTTTAAACAAGG + Intergenic
1190372454 X:49755859-49755881 GAATTTAATATGTGTAGCTCAGG + Intergenic
1191935691 X:66424790-66424812 GCATTAAACAAGTGTAAATCTGG - Intergenic
1191977569 X:66890570-66890592 GCACTTACTATGTGTGAGGCTGG + Intergenic
1193168617 X:78310497-78310519 CCACTTAATATGTATCAATTCGG + Intronic
1194236054 X:91384169-91384191 GCACTTTATATGGCAAAATCAGG - Intergenic
1196144438 X:112301401-112301423 GCATTTACTATGTGCCAATCAGG - Intergenic
1197802111 X:130361850-130361872 GCTGTTAATATGTAAAAATCAGG - Intronic
1198068824 X:133127670-133127692 GCACTTAATATATTCTAATCTGG - Intergenic
1199215513 X:145256469-145256491 GCACTCAAAAAGTGTAAGTCTGG - Intergenic
1201528930 Y:14970199-14970221 GCACATAATAGGTGTCTATCAGG - Intergenic