ID: 1139630188

View in Genome Browser
Species Human (GRCh38)
Location 16:68226573-68226595
Sequence AGTGGGACCCACCATTTGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139630174_1139630188 26 Left 1139630174 16:68226524-68226546 CCTTGGACCTTGGGTTTCCAACT 0: 1
1: 0
2: 0
3: 10
4: 179
Right 1139630188 16:68226573-68226595 AGTGGGACCCACCATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 174
1139630177_1139630188 9 Left 1139630177 16:68226541-68226563 CCAACTCTGCAGCCTTCAGGTCT 0: 1
1: 0
2: 5
3: 23
4: 297
Right 1139630188 16:68226573-68226595 AGTGGGACCCACCATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 174
1139630175_1139630188 19 Left 1139630175 16:68226531-68226553 CCTTGGGTTTCCAACTCTGCAGC 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1139630188 16:68226573-68226595 AGTGGGACCCACCATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 174
1139630182_1139630188 -3 Left 1139630182 16:68226553-68226575 CCTTCAGGTCTGGGGCCAGGAGT 0: 1
1: 0
2: 0
3: 34
4: 222
Right 1139630188 16:68226573-68226595 AGTGGGACCCACCATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139630188 Original CRISPR AGTGGGACCCACCATTTGTG GGG Exonic
902173060 1:14628684-14628706 GGTGGGACCCACCCCTTGTAAGG - Intronic
904005746 1:27362297-27362319 AGTGAGGCCCACCATTTCTGTGG + Intronic
907780746 1:57563742-57563764 AGGGGCACCCACCATTGCTGAGG + Intronic
912730981 1:112103439-112103461 AATGAGGCCCACCAGTTGTGGGG - Intergenic
915752131 1:158221487-158221509 AGGGGCACCCACCATTGCTGAGG - Intergenic
916221428 1:162448610-162448632 AGGGGAACCCACCATTGCTGAGG + Intergenic
917003483 1:170386240-170386262 AGGGGGACCCAGCAATTTTGAGG - Intergenic
917010379 1:170464315-170464337 AGGGGCACCCACCATTGCTGAGG + Intergenic
920279292 1:204830716-204830738 AGTGGCAACCACAATTTCTGGGG - Intronic
1065413570 10:25459394-25459416 AGTTGGACCCAGCATCTATGAGG - Intronic
1066060472 10:31719366-31719388 AGGGGCACCCACCATTGCTGAGG - Intergenic
1068413196 10:56684258-56684280 AGGGGCACCCACCATTGCTGAGG + Intergenic
1068825624 10:61435534-61435556 CGTGGGACCCACCATGTGGAAGG - Intronic
1069231787 10:66019445-66019467 AGTGGGATCCCCCACTTTTGGGG - Intronic
1071302543 10:84266980-84267002 AGTGAGAACCACCACTTTTGGGG + Intergenic
1071470272 10:85979274-85979296 AGTGGGACCCAAGAGTGGTGAGG + Intronic
1077562041 11:3270237-3270259 AGGGGCACCCACCATTACTGAGG - Intergenic
1077567935 11:3316057-3316079 AGGGGCACCCACCATTACTGAGG - Intergenic
1078743419 11:14089970-14089992 AGGGGCATCCACCATTTCTGAGG - Intronic
1079440081 11:20504595-20504617 AGTGGGTCTCTCCATTTATGTGG + Intronic
1080482614 11:32667351-32667373 AGGGGCACCCACCATTGCTGAGG - Intronic
1082174481 11:49045879-49045901 AGGGGCACCCACCATTTCTGAGG - Intergenic
1082268996 11:50149280-50149302 AGGGGCACCCACCATTGCTGAGG + Intergenic
1083139012 11:60706210-60706232 AATAGGAGCTACCATTTGTGGGG - Intronic
1086529195 11:87764077-87764099 AGGGGCACCCACCATTGCTGAGG - Intergenic
1086770206 11:90752978-90753000 ACTCAGACACACCATTTGTGTGG - Intergenic
1087830968 11:102819713-102819735 AGGGGCATCCACCATTAGTGAGG - Intergenic
1088746232 11:112807217-112807239 AGAGGGAGTCAGCATTTGTGGGG + Intergenic
1089189126 11:116641541-116641563 AGTGATACCCACCATTTATCAGG - Intergenic
1092718473 12:11416606-11416628 AGGGGCACCCACCATTGCTGAGG + Intronic
1097369078 12:58753823-58753845 AGTGGGATCCAGGTTTTGTGGGG + Intronic
1098072886 12:66695174-66695196 AGTGGGGCTGACCATGTGTGAGG + Intronic
1099512646 12:83556251-83556273 AGAGGCACCCACCATTGCTGAGG - Intergenic
1102962623 12:117102478-117102500 AGTGGCACCCACCATCTGCCCGG + Intergenic
1103354948 12:120312768-120312790 AGTGGTAACCACCCCTTGTGCGG + Intronic
1103718419 12:122960031-122960053 GCTGGGAGCCACCATTGGTGTGG - Exonic
1105299054 13:19117055-19117077 AATGGGAACCAGCACTTGTGTGG - Intergenic
1105488916 13:20867831-20867853 AGTGGGAGCCATCTTTTGTAAGG - Intronic
1108905060 13:55459116-55459138 AGTGGGACACACAAATTCTGTGG + Intergenic
1112612556 13:100969887-100969909 AGGGGCACCCACCATTGCTGAGG - Intergenic
1114236451 14:20828109-20828131 TGTGGGACCCACCCAGTGTGAGG - Intergenic
1114751939 14:25214465-25214487 AGTGGGACCCAACATCAATGGGG - Intergenic
1115717687 14:36124116-36124138 AGGGGCACCCACCATTGCTGAGG - Intergenic
1117251457 14:53943571-53943593 AGTGGGACTCACTCTTTATGAGG - Intergenic
1117436925 14:55724379-55724401 AGTGAGACCCACCATGTCTCAGG - Intergenic
1120633628 14:86923820-86923842 AGTGGTCCCCAACCTTTGTGGGG - Intergenic
1121899001 14:97674947-97674969 AGGGGGATCCACCATTACTGAGG + Intergenic
1128854153 15:70993069-70993091 AGGGGCACCCACCATTGCTGAGG - Intronic
1129368109 15:75069423-75069445 GGTCAGCCCCACCATTTGTGAGG - Intronic
1130432358 15:83861119-83861141 AGGGGCACCCACCATTGCTGAGG + Intronic
1130729336 15:86474528-86474550 AGGGGCACCCACCATTGCTGAGG + Intronic
1130737505 15:86565819-86565841 AGGGGCACCCACCATTGCTGAGG - Intronic
1130778078 15:87006380-87006402 AGGGGCACCCACCATTGCTGAGG - Intronic
1132139724 15:99382219-99382241 AGGGGCACCCACCATTGCTGAGG - Intronic
1132505496 16:306462-306484 GGTGGGACCCTCCGTGTGTGTGG + Intronic
1133267158 16:4592060-4592082 AGAGGGACCCAATATTTATGGGG + Intronic
1134879578 16:17733594-17733616 AGGGGCACCCACCATTGCTGAGG + Intergenic
1137371462 16:47910311-47910333 AGGGGCACCCACCATTGCTGAGG + Intergenic
1137503429 16:49029119-49029141 AGGGGGGCCCACCATTGCTGTGG + Intergenic
1139630188 16:68226573-68226595 AGTGGGACCCACCATTTGTGGGG + Exonic
1141235151 16:82209449-82209471 AGGGGCACCCACCATTGCTGAGG - Intergenic
1142187508 16:88701493-88701515 CTTAGGACCCAGCATTTGTGGGG + Intronic
1147185249 17:38709871-38709893 AGTAAGAGCCAACATTTGTGTGG + Intronic
1149123403 17:53197549-53197571 AGTGGGGACCACCAAATGTGGGG - Intergenic
1156782876 18:40871967-40871989 AGTGGCAGCCACTATTTCTGTGG + Intergenic
1157067887 18:44373606-44373628 AGAGGCAGCCACCATCTGTGTGG - Intergenic
1159143472 18:64424709-64424731 AGGGGCACCCACCATTGCTGAGG + Intergenic
1162384038 19:10350619-10350641 TGAGGGACCCAACATTTGTAGGG - Exonic
1164493424 19:28735689-28735711 AGTGTGACCCACCAACTTTGAGG - Intergenic
1164568379 19:29348788-29348810 AGGGGCACCCACCATTGCTGAGG + Intergenic
927302061 2:21526655-21526677 AGGGGCACCCACCATTGCTGAGG - Intergenic
927431931 2:23034192-23034214 ATTGGGACACAACATTTGAGGGG - Intergenic
928864958 2:35906580-35906602 AGTGGCATCCACCATTGCTGAGG - Intergenic
931474757 2:62576254-62576276 ACTGGGCCCCACAAATTGTGTGG + Intergenic
931475806 2:62586536-62586558 AGGGGCACCCACCATTGCTGAGG - Intergenic
931491679 2:62754676-62754698 AGGGGCACCCACCATTGCTGAGG - Intronic
936945182 2:117923568-117923590 AGGGGCACCCGCCATTTCTGAGG + Intronic
937186769 2:120051343-120051365 AGGGGCACCCACCATTGCTGAGG - Intronic
940054525 2:149500037-149500059 AGGGGGATCCACCATTACTGAGG - Intergenic
940602100 2:155875400-155875422 AGGGGCACCCACCATTGCTGAGG + Intergenic
940793102 2:158048788-158048810 CCTGGGATCTACCATTTGTGTGG + Intronic
942000995 2:171646960-171646982 AGGGGCACCCACCATTGCTGAGG - Intergenic
942049825 2:172129115-172129137 TGTGGTACCCACCACTTGGGAGG - Intergenic
943084991 2:183300627-183300649 AGGGGCACCCACCATTGCTGAGG - Intergenic
946109918 2:217405782-217405804 ACTGGGACACTCCATCTGTGTGG - Intronic
947098304 2:226591772-226591794 AGAGGCAGCCACCATTTCTGTGG - Intergenic
948025886 2:234775900-234775922 AGGGGGGCCCACCATTGCTGAGG + Intergenic
1169041781 20:2501261-2501283 AGGGGCACCCACCATTGCTGAGG + Intronic
1170405172 20:16028188-16028210 AGAGTGAGCCACCTTTTGTGAGG - Intronic
1170483621 20:16793525-16793547 AGGGGCGCCCACCATTTCTGAGG - Intergenic
1172899225 20:38321546-38321568 AGTGGGACCCACTCTTGCTGGGG - Intronic
1173301393 20:41806952-41806974 AGGGGCACCCACCATTGCTGAGG - Intergenic
1175221743 20:57421249-57421271 GCTGGGACCCACCCTGTGTGGGG + Intergenic
1178401776 21:32292744-32292766 ATTGGGAGCCAACATTTGGGAGG - Intronic
1180598983 22:17001851-17001873 AGGGGCACCCACCATTGCTGAGG - Intronic
1181554902 22:23663428-23663450 AGAGGCACCCACCATTGCTGAGG + Intergenic
1182106741 22:27695142-27695164 ACAGGGACCCTTCATTTGTGAGG + Intergenic
1184886747 22:47351216-47351238 AGGGGCACCCACCATTGCTGAGG - Intergenic
949288036 3:2429771-2429793 AGGGGCACCCACCATTGCTGAGG - Intronic
949865890 3:8546822-8546844 AGTGGGACACAGGTTTTGTGAGG + Intronic
950835193 3:15912922-15912944 AGGGGCACCCACCATTTCTCAGG - Intergenic
951394965 3:22153793-22153815 AGTGGGCCCTACAAATTGTGTGG + Intronic
952905916 3:38139012-38139034 GCTGGGACCCAGCATTGGTGAGG + Exonic
955562328 3:60205149-60205171 GGTGGGATCCAGCCTTTGTGTGG - Intronic
962287710 3:134101750-134101772 AGGGGCACCCACCATTGCTGAGG - Intronic
962726351 3:138231762-138231784 AGTGAGACCCCCCATCTCTGGGG + Intronic
965730594 3:171768095-171768117 AGTTTGACCCAGCATTTCTGGGG - Intronic
971560759 4:28077377-28077399 AGGGGCACCCACCATTGCTGAGG + Intergenic
971621318 4:28857201-28857223 AGGGGCACCCACCATTGCTGAGG - Intergenic
972790459 4:42366769-42366791 AGTGGGAGTCTCCATTTCTGAGG + Intergenic
973116785 4:46470862-46470884 AGTGGGACTAACCAATTGTGGGG + Intronic
973648156 4:52970470-52970492 AGGGGCACCCACCATTGCTGAGG + Intronic
974298414 4:60034343-60034365 AGTGGCAACCACCATTACTGTGG - Intergenic
974470213 4:62309698-62309720 AGGGGCACCCACCATTGCTGAGG + Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975286983 4:72632491-72632513 AGGGGCACCCACCATTGATGAGG + Intergenic
975352419 4:73360584-73360606 AGGGGCACCCACCATTGCTGAGG + Intergenic
981096581 4:140788397-140788419 AGTGGCTCCCACCATTGCTGAGG - Intergenic
982393630 4:154892310-154892332 AGGGGCACCCACCATTACTGAGG + Intergenic
983175749 4:164586055-164586077 AGGGGCACCCACCATTGCTGAGG + Intergenic
996370410 5:122747163-122747185 AGTGGGAGCCACGACATGTGTGG + Intergenic
997137758 5:131344452-131344474 AGTGGCATCCACCATTGTTGAGG + Intronic
997874396 5:137535555-137535577 AGGGGCACCCACCATTGCTGAGG + Intronic
998156928 5:139792362-139792384 AGAGGGACCCACCAATTGGGAGG - Intergenic
998241722 5:140452173-140452195 AGGGGCACCCACCATTGCTGAGG + Intronic
998256866 5:140594694-140594716 TGTGGGCCCCACCAGGTGTGTGG + Intergenic
1000280459 5:159777345-159777367 AGTGGGATGCACCATCTGGGAGG - Intergenic
1001311185 5:170612211-170612233 AGTGGGACCCACTCCATGTGGGG - Intronic
1003228648 6:4229333-4229355 AGGGGCACCCACCATTGCTGAGG + Intergenic
1005795766 6:29360083-29360105 AGGGGCATCCACCATTAGTGAGG + Intronic
1006054533 6:31373693-31373715 AGTGGGTCTCTCCCTTTGTGTGG + Intergenic
1007239715 6:40416331-40416353 AGTGGCACCCAACAGTGGTGGGG + Intronic
1007823557 6:44580133-44580155 AGGTGGCCCCACGATTTGTGTGG + Intergenic
1007938539 6:45755192-45755214 AGTGGGAGCCATGATGTGTGTGG + Intergenic
1008281264 6:49598995-49599017 AGGGGCACCCACCATTGCTGAGG + Intergenic
1010944514 6:81958718-81958740 AGGGGCACCCACCATTGCTGAGG - Intergenic
1011139219 6:84134181-84134203 AGTGGCATCCACCATTACTGAGG - Intronic
1011294918 6:85816377-85816399 AGGGGCACCCACCATTGCTGAGG + Intergenic
1011296801 6:85835058-85835080 AGGGGCACCCACCATTGCTGAGG - Intergenic
1013235747 6:108196676-108196698 AGTGGGACTCAGCAAGTGTGAGG + Intergenic
1013378250 6:109540291-109540313 AGGGGCACCCACCATTGCTGAGG - Intronic
1014569049 6:122986507-122986529 AGTGGCATCCACCATTACTGAGG + Intergenic
1015524297 6:134160787-134160809 AGTTGGGCCCACCAGGTGTGTGG + Intergenic
1024205867 7:47160115-47160137 AGGGGCACCCACCATTGCTGAGG + Intergenic
1026299887 7:69088779-69088801 AGTTAAACCCACCAATTGTGTGG - Intergenic
1030131974 7:106209160-106209182 AGGGGCACCCACCATTGCTGAGG + Intergenic
1030510052 7:110472658-110472680 AGGGGTACCCACCATTGCTGAGG + Intergenic
1031344714 7:120651304-120651326 AGGGGCACCCACCATTGCTGAGG - Intronic
1033465263 7:141583570-141583592 AGTGGCAACCACCATTTTTTGGG - Intronic
1034462408 7:151205150-151205172 AGTGGGGCCCTCCAGGTGTGGGG + Intronic
1035812787 8:2506426-2506448 AGTGGTATCCAGCATTTCTGAGG + Intergenic
1037786866 8:21908558-21908580 AGTGGGAGTCACCAGGTGTGTGG - Intergenic
1040389932 8:46941151-46941173 AGTGGCACTCACCATTGCTGAGG + Intergenic
1044811802 8:96070856-96070878 AGGGGCACCCACCATTGCTGAGG + Intergenic
1045143534 8:99313856-99313878 AGGGGCACCCACCATTGCTGAGG - Intronic
1045709279 8:104964381-104964403 AGGGGCACCCACCATTGCTGAGG - Intronic
1045768287 8:105703396-105703418 AGTGGGACTCACCACTTGGAAGG + Intronic
1049170448 8:141157437-141157459 AGTTGGACCCACAGGTTGTGAGG - Intronic
1050404498 9:5293396-5293418 AGGGGGATCCACCATTGTTGAGG + Intergenic
1052382332 9:27785029-27785051 AGTGGCATCCACCATTACTGAGG - Intergenic
1056095701 9:83250885-83250907 AGGGGCAGCCACCATTTCTGTGG + Intronic
1056764040 9:89433863-89433885 AGTGTGACCCACACTTAGTGCGG - Intronic
1058866412 9:109166285-109166307 AGTGCGAGCCACCATTGTTGTGG - Intronic
1186390839 X:9157479-9157501 AGTGGAATCCACAATTTGTTAGG + Intronic
1189200029 X:39186049-39186071 AGGGGCACCCACCATTGCTGAGG - Intergenic
1189929785 X:45996679-45996701 AGGGAGAGCCACCAATTGTGAGG - Intergenic
1192755146 X:74039627-74039649 AGGGGCACCCACCATTGCTGAGG - Intergenic
1192871801 X:75191651-75191673 AGGGGCACCCACCATTGCTGAGG - Intergenic
1193389176 X:80906421-80906443 AGGGGCACCCACCATTACTGAGG + Intergenic
1194837466 X:98698935-98698957 AGGGGCACCCACCATTACTGAGG - Intergenic
1196214615 X:113035872-113035894 AGGGAGAACCACCAATTGTGAGG - Intergenic
1196489873 X:116253145-116253167 AGAGGCACCCACCATTGCTGAGG + Intergenic
1198166443 X:134062341-134062363 AGGGGCACCCACCATTGCTGAGG - Intergenic
1200778779 Y:7195658-7195680 AGGGGCACCCACCATTGCTGAGG - Intergenic
1200871358 Y:8102124-8102146 AGGGGCGCCCACCATTTCTGAGG - Intergenic
1202170788 Y:22041361-22041383 AATGGCACCCACCATTGCTGAGG + Intergenic
1202220575 Y:22545012-22545034 AATGGCACCCACCATTGCTGAGG - Intergenic
1202322538 Y:23650651-23650673 AATGGCACCCACCATTGCTGAGG + Intergenic
1202548235 Y:26019405-26019427 AATGGCACCCACCATTGCTGAGG - Intergenic