ID: 1139632227

View in Genome Browser
Species Human (GRCh38)
Location 16:68237614-68237636
Sequence GAGACGCATGGGCCAGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139632227_1139632238 10 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632238 16:68237647-68237669 AGCGGTAAGCGAATCAGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1139632227_1139632241 13 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632241 16:68237650-68237672 GGTAAGCGAATCAGGCGCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 65
1139632227_1139632231 -8 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632231 16:68237629-68237651 TGCGTCTCCTCCCCCGGAAGCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1139632227_1139632237 5 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632237 16:68237642-68237664 CCGGAAGCGGTAAGCGAATCAGG 0: 1
1: 0
2: 0
3: 0
4: 15
1139632227_1139632243 18 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632243 16:68237655-68237677 GCGAATCAGGCGCGGGGGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 43
1139632227_1139632242 17 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632242 16:68237654-68237676 AGCGAATCAGGCGCGGGGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1139632227_1139632239 11 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632239 16:68237648-68237670 GCGGTAAGCGAATCAGGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1139632227_1139632240 12 Left 1139632227 16:68237614-68237636 CCGGGCACTGGCCCATGCGTCTC 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1139632240 16:68237649-68237671 CGGTAAGCGAATCAGGCGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139632227 Original CRISPR GAGACGCATGGGCCAGTGCC CGG (reversed) Intronic
900485903 1:2922662-2922684 GAGACTCAGGAGCCAGAGCCCGG + Intergenic
900519799 1:3100071-3100093 GAGACCCACAGGGCAGTGCCGGG - Intronic
900592195 1:3465110-3465132 GAGCCCCATGGGCCTGGGCCTGG - Intronic
900629321 1:3625274-3625296 GTGAGGCAGGGGCCAGGGCCGGG + Intronic
901616422 1:10543524-10543546 GAGACGCATGTGCCAGTCGCTGG + Intronic
901650943 1:10743015-10743037 AAGAAGCCTGGGCCAGTTCCTGG + Intronic
902180756 1:14686702-14686724 GAGAAGCCAGGGCCAGTGCCAGG - Intronic
902955752 1:19923288-19923310 GAGGGGCATGGGCCAGGGGCTGG - Intronic
903138891 1:21326853-21326875 GAGACGCAGGGGCCAAAGGCTGG - Intronic
904265984 1:29318838-29318860 GTGAAGGATGGGCCAGGGCCAGG + Intronic
904755203 1:32765207-32765229 GAGGGGCAGGGGCCAGTCCCAGG - Intronic
904826521 1:33276828-33276850 GAGCCCCATGGGGCAGTGACCGG - Intronic
905218364 1:36426459-36426481 GGGATGGATGGGTCAGTGCCAGG - Intronic
912705066 1:111905509-111905531 CAGACGCATGGTCCAGTGTTTGG - Intronic
913055790 1:115158404-115158426 GAGAAGCTTGAGCCAGTTCCTGG + Intergenic
915142618 1:153776640-153776662 GAAGTGGATGGGCCAGTGCCAGG + Exonic
915468812 1:156113924-156113946 GAGATGGAAGGGGCAGTGCCTGG + Intronic
915957306 1:160232242-160232264 TATAGGCATGAGCCAGTGCCTGG - Intronic
916006551 1:160666274-160666296 GAGACACATTGGGCAGAGCCCGG + Intergenic
916011792 1:160712740-160712762 TATAGGCATGGGCCTGTGCCTGG + Intergenic
917490774 1:175496589-175496611 GATATGCCTTGGCCAGTGCCTGG - Intronic
920851096 1:209628157-209628179 GATCCGGATGGGGCAGTGCCAGG - Exonic
921930206 1:220748578-220748600 GAGCCACCTGGGCCAGGGCCGGG - Exonic
924392714 1:243580716-243580738 GATTCGCATGTGCCATTGCCGGG + Intronic
1064329424 10:14379755-14379777 GAGACACAGGGGTCACTGCCTGG + Intronic
1065685533 10:28280833-28280855 GAGACAAATGGGCATGTGCCTGG + Intronic
1067478793 10:46582482-46582504 GAGCCCCATAGGCCAGGGCCTGG - Intronic
1067615946 10:47759319-47759341 GAGCCCCATAGGCCAGGGCCTGG + Intergenic
1070660916 10:78304643-78304665 GAGACAGATGTGCCAGAGCCAGG - Intergenic
1072463990 10:95646355-95646377 GGGTCGCATGGTTCAGTGCCAGG + Intronic
1072667000 10:97400979-97401001 GAGACGAAAGGTCCAATGCCTGG + Intronic
1074415645 10:113264709-113264731 CAGACACATGGGCCCCTGCCTGG + Intergenic
1075450418 10:122547649-122547671 GGGCAGCATGTGCCAGTGCCTGG - Intergenic
1076338789 10:129728589-129728611 GAGGGGCATGGGCAAGAGCCAGG - Intronic
1076407016 10:130219160-130219182 GTGAGGCTTGGCCCAGTGCCGGG - Intergenic
1076441031 10:130481520-130481542 GAGACACCTGGCCCTGTGCCTGG - Intergenic
1076785475 10:132747565-132747587 GACACCCCTGGGCCGGTGCCCGG - Intronic
1076869713 10:133187346-133187368 AAGACGCTTGGGCCAAGGCCTGG + Intronic
1077028729 11:453670-453692 GAGCCAGAAGGGCCAGTGCCCGG + Intronic
1078884796 11:15489674-15489696 GGGACCCATGGCCCATTGCCTGG + Intergenic
1081908894 11:46687431-46687453 GAGCTGCTTGGGACAGTGCCAGG + Intronic
1083778526 11:64906393-64906415 GGGCCGCAAGGGCCAGGGCCGGG - Exonic
1083975153 11:66112678-66112700 GTTGTGCATGGGCCAGTGCCAGG + Intronic
1084658115 11:70531250-70531272 GAGAGGCATGGCCCAGGCCCAGG + Intronic
1086369340 11:86141031-86141053 GAGAGGGATGGGCCACTGCAAGG - Intergenic
1088511482 11:110580103-110580125 GAGCCGGATGGGGAAGTGCCTGG + Exonic
1089792250 11:120953589-120953611 GAGACGCACGGGCCAGACCAGGG + Intronic
1091004156 11:131937418-131937440 GCGATGCATGGGCCACTGACAGG + Intronic
1091408631 12:224529-224551 GAGGAACACGGGCCAGTGCCCGG + Intronic
1095202815 12:39405074-39405096 TATATGCATGAGCCAGTGCCTGG - Intronic
1100268358 12:93000050-93000072 GAGACTGATGGGCCAGAGACAGG - Intergenic
1103083897 12:118046631-118046653 CAAACTCAGGGGCCAGTGCCAGG - Intronic
1103418180 12:120758708-120758730 AAGACTCATGGGCCAGGGCCGGG - Intergenic
1105546123 13:21352249-21352271 AAGACCCAGGGGCCAGAGCCAGG + Intergenic
1106700420 13:32222778-32222800 GAAATGCATAGGCCAGTGCCTGG + Intronic
1107396097 13:40019069-40019091 GAGAGACATGGGGCAGTGGCTGG + Intergenic
1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG + Intronic
1119189998 14:72674763-72674785 GAGAGGAAAGAGCCAGTGCCTGG + Intronic
1120128833 14:80781180-80781202 GACAGGCATGAGCCACTGCCTGG - Intronic
1121652882 14:95572965-95572987 GAGCCACCTGGCCCAGTGCCTGG - Intergenic
1121658036 14:95612616-95612638 CAGATGCCTGGGACAGTGCCTGG + Intergenic
1122412661 14:101533914-101533936 CCGACGCATGGGCCAGTATCTGG - Intergenic
1123018739 14:105387718-105387740 GAGGCCCATGGGGCAGTGCGTGG - Intronic
1124195212 15:27619422-27619444 GAGCCGCCTGTGCCTGTGCCGGG - Intergenic
1125478444 15:40063429-40063451 GAGTGGCATGGGACAGTGCATGG - Intergenic
1125768888 15:42152360-42152382 GAGACGCATGGCACAGGGCTGGG + Intronic
1128108130 15:65059145-65059167 GAGAAGGATGGGACAGGGCCTGG - Intronic
1129719105 15:77868193-77868215 CAGAGCCAGGGGCCAGTGCCTGG + Intergenic
1130095669 15:80854061-80854083 GAGGCCCAGGGGACAGTGCCTGG - Intronic
1130459830 15:84152679-84152701 CAGAGCCAGGGGCCAGTGCCTGG - Intergenic
1130756271 15:86767303-86767325 GAGACGAATGGGCCTTTGTCTGG + Intronic
1132711730 16:1271859-1271881 CAGAGACATGGGCCAGGGCCAGG - Intergenic
1132954408 16:2583860-2583882 GGGACCCCGGGGCCAGTGCCGGG - Intronic
1132959937 16:2616303-2616325 GGGACCCCGGGGCCAGTGCCGGG + Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134257782 16:12625975-12625997 GAGCAGCACGGGCCTGTGCCAGG + Intergenic
1138015183 16:53421406-53421428 GAGAGGCATGGGCGGGAGCCGGG - Intergenic
1139632227 16:68237614-68237636 GAGACGCATGGGCCAGTGCCCGG - Intronic
1140240028 16:73192113-73192135 GAGGCTCATGTGCTAGTGCCAGG - Intergenic
1141232404 16:82181443-82181465 TACAGGCATGGGCCACTGCCTGG + Intergenic
1141626584 16:85264579-85264601 GAGAGGAAGGGGCCAGGGCCGGG + Intergenic
1141849449 16:86635138-86635160 GAGACGCATGGGCGAATTCAAGG + Intergenic
1142486266 17:249430-249452 AAGCCTCAAGGGCCAGTGCCAGG + Intronic
1144769560 17:17752170-17752192 CATACCCACGGGCCAGTGCCGGG + Intronic
1144779454 17:17800514-17800536 GACACCCATGGGCCAGGGACAGG - Intronic
1144995250 17:19263678-19263700 GAAACCCCTGGGTCAGTGCCTGG + Intronic
1147046437 17:37755587-37755609 CAGATGCATGGCCCAGTGGCTGG + Intergenic
1147970352 17:44216150-44216172 GGTAGGCATGGGCCAGTGCCTGG - Intronic
1150868707 17:68880657-68880679 GTGGCGCCTGTGCCAGTGCCTGG + Intronic
1151703225 17:75754116-75754138 CAGAGGCAGGGCCCAGTGCCAGG + Intronic
1151715190 17:75827617-75827639 GAGGCAGATGGGCCAGGGCCAGG + Exonic
1151860468 17:76757362-76757384 TAGACTCAGGGGCCAGTTCCTGG + Intronic
1152815480 17:82405207-82405229 GAGGCCCAGGGGCCAGGGCCAGG - Intronic
1155442596 18:25877674-25877696 GAGACGCAGGGGTTAGTTCCAGG - Intergenic
1157402310 18:47398756-47398778 GAGACCCTTGAGCCAATGCCTGG - Intergenic
1157553562 18:48597926-48597948 GAGACCCAGTGGCCAGTGCAGGG + Intronic
1160177058 18:76603520-76603542 CAGGAGCATGGGCCAGAGCCTGG - Intergenic
1161068796 19:2250488-2250510 GAGTTGCATGGGGCAGTGCCCGG + Intronic
1161477459 19:4494403-4494425 GGGACGCAAGGGCCGGGGCCGGG + Exonic
1162724702 19:12683035-12683057 GAAACGAATGGGCGAGTGCCGGG - Intergenic
1162821901 19:13228279-13228301 GGGGAGCAGGGGCCAGTGCCAGG + Intronic
1163643398 19:18474490-18474512 GAGAAGCATGGGGCAGTTTCTGG - Intronic
1165093699 19:33399503-33399525 GGGACGCTGGGGGCAGTGCCAGG - Intronic
1165393238 19:35550163-35550185 GAGACGCTGAGGACAGTGCCTGG + Exonic
1168354954 19:55695153-55695175 GTGACGGAAGGGCCAGTGGCTGG - Exonic
926340208 2:11898987-11899009 CAGAACCATGGGCCAGGGCCAGG + Intergenic
932050925 2:68396749-68396771 GAGAGGCCTGGGCAACTGCCTGG + Exonic
932374938 2:71227142-71227164 TAGACGAATGGGGCGGTGCCCGG - Intergenic
937964105 2:127488060-127488082 CAAAAGCATGGGCCAGTGGCAGG - Intronic
940250064 2:151665252-151665274 GAGACGATTGGGGCACTGCCAGG + Intronic
941096262 2:161242118-161242140 AGGACACATGGGCAAGTGCCAGG - Intergenic
946474667 2:219995897-219995919 CAGAGGCGTGGGCCAGTGCGTGG - Intergenic
948614101 2:239187245-239187267 GAGAGGCACAGGGCAGTGCCTGG + Intronic
1168821083 20:774254-774276 GTGACCCCTGGGGCAGTGCCAGG + Intergenic
1169104779 20:2985540-2985562 GAGGCGGATGAGTCAGTGCCTGG + Intronic
1169171847 20:3471444-3471466 CAGACGCACTGGCCGGTGCCAGG - Exonic
1169781622 20:9316256-9316278 CATACGCCTGGGCCAGTTCCTGG - Intronic
1172700740 20:36852279-36852301 GAGACGAGTGGCCCAGAGCCAGG - Intronic
1173643329 20:44618425-44618447 GAGGCTGCTGGGCCAGTGCCAGG - Exonic
1173813326 20:45969600-45969622 GTGTCTCATGGGCCAGTGGCAGG - Exonic
1176030028 20:63007302-63007324 GACACGCAGGGGCCAGAGCGGGG + Intergenic
1176431572 21:6579368-6579390 GAGGCCCCTGGGCCAGTGGCAGG + Intergenic
1179143808 21:38750498-38750520 GACACGCATGAGTCACTGCCTGG - Intergenic
1179706966 21:43186830-43186852 GAGGCCCCTGGGCCAGTGGCAGG + Intergenic
1181527697 22:23499508-23499530 GAGAAGAAAGGGCCAGGGCCAGG + Intergenic
1182428472 22:30287016-30287038 GAGAGGCGTGGGCCAGGGGCAGG + Intronic
1182770464 22:32792085-32792107 AAGATGCATGGCACAGTGCCTGG - Intronic
1184850431 22:47116616-47116638 GAGATGCAGGGCCCAGGGCCAGG - Intronic
950187807 3:10956186-10956208 GAGACGCATGGCCAAGTGTCTGG - Intergenic
953829708 3:46285498-46285520 GAGAGGCATGGCCCAGGCCCAGG - Intergenic
956400952 3:68879132-68879154 GAAGCCCATGGGACAGTGCCAGG + Intronic
956702752 3:71973093-71973115 GAGCCTCATGGGCCAGCCCCTGG - Intergenic
961362801 3:126378607-126378629 CAGACACGTGGGCCAGGGCCAGG + Intergenic
963283903 3:143413972-143413994 TAAAGGCAAGGGCCAGTGCCTGG + Intronic
964747560 3:160026531-160026553 GGGAGGGATGGGGCAGTGCCTGG - Intronic
966933054 3:184688043-184688065 GAAACGCCTCGCCCAGTGCCTGG - Intergenic
967184103 3:186930710-186930732 AAGACGCCTGGGGCACTGCCCGG + Exonic
967912751 3:194555764-194555786 GAGACCCAGTGGCCTGTGCCAGG - Intergenic
968814415 4:2814633-2814655 GAGACACATGGGCCAGCGTTGGG - Intronic
970379692 4:15494309-15494331 GAGACGCATGTGCCAGAGCCGGG + Intronic
973924985 4:55728280-55728302 GAGAGACATGGGGCAGGGCCTGG + Intergenic
976325248 4:83763681-83763703 GAGACACATAGGGCAGAGCCTGG - Intergenic
979252370 4:118578847-118578869 TACAGGCATGGGCCACTGCCCGG + Intergenic
980705964 4:136495249-136495271 GCCAAGCATGGGCCAGTGCCCGG - Intergenic
984941339 4:184934977-184934999 GAGAATCAGGGGCCAGTGACAGG - Intergenic
985942821 5:3152061-3152083 GGGACGGAGGGACCAGTGCCAGG + Intergenic
987194457 5:15511599-15511621 GAGAAGCCTGGGCCAGGGACTGG - Intronic
989657328 5:43759046-43759068 TATAGGCATGAGCCAGTGCCCGG + Intergenic
992120526 5:73587602-73587624 GAAACAGATGGGCCAGAGCCAGG - Intergenic
997529816 5:134575073-134575095 CAGAAGCATGGGCAAGAGCCTGG + Intronic
998166783 5:139848711-139848733 CAGAGGCATGGGCCAGGGCCAGG + Intronic
998948087 5:147362804-147362826 TACAGGCATGAGCCAGTGCCTGG - Intronic
999309019 5:150539451-150539473 GAGAGGCATGAGTGAGTGCCTGG + Intronic
999569432 5:152901943-152901965 GAGACCCATAGGCCAATGCAGGG - Intergenic
1001309809 5:170602748-170602770 GAGACCCATCCGCCAGGGCCAGG - Intronic
1002084964 5:176768776-176768798 GAGAGGCAGGGGCCAGGGCCAGG + Intergenic
1002253148 5:177941923-177941945 GAGAAGCCAGGGCCAGGGCCTGG + Intergenic
1003405502 6:5824189-5824211 AAGACCCATGGGCTAGAGCCAGG - Intergenic
1009872229 6:69467204-69467226 GAGACGCATGGGCAGGAACCGGG + Intergenic
1015142868 6:129955408-129955430 GATCCGCCTGGGCTAGTGCCTGG + Intergenic
1020017336 7:4838617-4838639 GACACGCAGGGGCCACTCCCAGG + Intronic
1022187003 7:27979650-27979672 GAGAAGCATGGGACTGTCCCTGG - Intronic
1022466879 7:30657964-30657986 TAGACGGATGGGCCAGTGGATGG - Intronic
1022492365 7:30830835-30830857 GAGCCACATGGGCAAATGCCTGG + Intronic
1023387297 7:39672382-39672404 TAGAAGCCTGGGACAGTGCCAGG + Intronic
1023472905 7:40544268-40544290 GAGACACAGGGGCCAGAGCCTGG - Intronic
1023828248 7:44024217-44024239 GAGAACCAGGGGGCAGTGCCAGG + Intergenic
1023852868 7:44159845-44159867 GAGAGGCCTGGGCCAGAGCCTGG - Intronic
1023871501 7:44265433-44265455 GGGACGTGTGGGCCAGAGCCAGG + Intronic
1024290033 7:47796511-47796533 GAGAGGCCTGTGCCTGTGCCTGG + Intronic
1026442339 7:70455403-70455425 CAGACGAATGAGCCAGGGCCAGG - Intronic
1027659767 7:80975118-80975140 GAGAGGCATGGGCGGGAGCCAGG - Intergenic
1029756549 7:102577663-102577685 GAGAACCAGGGGGCAGTGCCAGG + Intronic
1029774491 7:102676732-102676754 GAGAACCAGGGGGCAGTGCCAGG + Intergenic
1033737024 7:144232363-144232385 GAACCACATGGGCCAGAGCCAGG + Exonic
1033746033 7:144318583-144318605 GAACCACATGGGCCAGAGCCAGG - Exonic
1034545297 7:151785227-151785249 GAGACACAGGGGCCACAGCCAGG - Intronic
1036138024 8:6180274-6180296 GCGATGCCTGGGCCAGTCCCTGG - Intergenic
1036683853 8:10895347-10895369 GACAGACATGGGCCAGTTCCAGG + Intergenic
1037967470 8:23145561-23145583 GAGACGCTTGGACCAGGGGCAGG + Intronic
1039010423 8:33087395-33087417 GAGGAGCATGGGCCGGTTCCAGG - Intergenic
1039434523 8:37550728-37550750 GAGACGCTTGGTCCAGGGCCAGG - Intergenic
1039614577 8:38944964-38944986 GAGACGCAGATGGCAGTGCCAGG + Intronic
1041496274 8:58488468-58488490 GATTCCCATGGGCCAGGGCCAGG - Intergenic
1045452210 8:102338591-102338613 GAGAAGCATGGTCCTGTCCCAGG - Intronic
1045647581 8:104314803-104314825 GTGAGGCCTGGGGCAGTGCCTGG - Intergenic
1045647762 8:104316327-104316349 GAGGCCCAAGGGACAGTGCCTGG - Intergenic
1047337636 8:123951871-123951893 GAGCAGCATGGGCCAGTACTGGG + Intronic
1047614747 8:126555321-126555343 GAGAGGGATGGGCCAGTGAGGGG + Exonic
1049428708 8:142549424-142549446 GAGAGGCCTGGGCCTGTGTCTGG + Intergenic
1049469420 8:142768834-142768856 GAGACACCTGAGCCAGCGCCAGG + Intronic
1052341794 9:27370841-27370863 GTGACTCAAGGGCCAGTGCTTGG - Intronic
1052855687 9:33404838-33404860 GTGAGGCAAGGGCCAGGGCCAGG + Intergenic
1058951158 9:109905337-109905359 GGCACGCATGAGCCAGGGCCAGG + Intronic
1059420399 9:114186960-114186982 GAGCCTCATGGCCCAGTGCAGGG - Intronic
1061086715 9:128403900-128403922 GAGCCGCTTCGGCCAGTGCTAGG - Intergenic
1061258316 9:129465615-129465637 CAGAGGCCTGGGCTAGTGCCTGG + Intergenic
1061565666 9:131438001-131438023 GTGACCCCTGTGCCAGTGCCAGG - Intronic
1062178823 9:135179730-135179752 GAGACACAGGGGGCAGTGCAGGG - Intergenic
1199248980 X:145637897-145637919 GGGAGGCATGGGCCTGTTCCTGG - Intergenic
1202379415 Y:24262487-24262509 CAGAGCCAGGGGCCAGTGCCTGG + Intergenic
1202491367 Y:25407634-25407656 CAGAGCCAGGGGCCAGTGCCTGG - Intergenic