ID: 1139632276

View in Genome Browser
Species Human (GRCh38)
Location 16:68237785-68237807
Sequence AGGGCGCCTGCGCTTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139632261_1139632276 10 Left 1139632261 16:68237752-68237774 CCGCGAGTAACGCTCCTCCCCCT 0: 1
1: 0
2: 0
3: 1
4: 67
Right 1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 155
1139632266_1139632276 -7 Left 1139632266 16:68237769-68237791 CCCCCTCCCGCCCGGTAGGGCGC 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 155
1139632268_1139632276 -9 Left 1139632268 16:68237771-68237793 CCCTCCCGCCCGGTAGGGCGCCT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 155
1139632269_1139632276 -10 Left 1139632269 16:68237772-68237794 CCTCCCGCCCGGTAGGGCGCCTG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 155
1139632264_1139632276 -4 Left 1139632264 16:68237766-68237788 CCTCCCCCTCCCGCCCGGTAGGG 0: 1
1: 0
2: 2
3: 102
4: 5829
Right 1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 155
1139632267_1139632276 -8 Left 1139632267 16:68237770-68237792 CCCCTCCCGCCCGGTAGGGCGCC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139632276 Original CRISPR AGGGCGCCTGCGCTTGGTGG AGG Intronic
900180339 1:1308420-1308442 AGAGCGCCTGCGCTCGGCGGCGG + Intronic
900411914 1:2516359-2516381 AGCGCGCCTGTGCTGGGTGCAGG - Intronic
902916843 1:19644578-19644600 AGGGCTCCTGAGCTCGGCGGCGG - Intronic
903349996 1:22711433-22711455 GGGGCGCCGGCGCTCGGTCGGGG + Intronic
905198732 1:36301977-36301999 AGGGAGGCTGAGGTTGGTGGTGG - Intronic
905856130 1:41315499-41315521 AAGGTGCCTGTGCTTGGAGGTGG - Intergenic
906205642 1:43985093-43985115 AGTGGGCCTGCGTCTGGTGGGGG - Intronic
916463502 1:165049594-165049616 AGGGCCCCTGCCCTGGGTGGAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
923947134 1:238900545-238900567 GGGACGCTGGCGCTTGGTGGGGG + Intergenic
1067830476 10:49609014-49609036 AGGGCGGCTGAGGTTGGAGGTGG - Intergenic
1068938828 10:62661275-62661297 AGGGCACCTGTGCATGGAGGTGG - Intronic
1069884576 10:71615693-71615715 AGGGCTCCTGCCCCCGGTGGTGG + Intronic
1069926035 10:71851377-71851399 AGGGCGCCTGCGCGAAGGGGAGG + Intergenic
1070771981 10:79087946-79087968 AGGGAGCCAGAGCCTGGTGGTGG - Intronic
1072691889 10:97577645-97577667 AGGGGCCCTGCTCTTGCTGGGGG + Intronic
1075587201 10:123666515-123666537 AGAGCGCCGGCGCCTGGCGGCGG - Exonic
1076674976 10:132142902-132142924 AGGGTGGCTGAGCTGGGTGGGGG + Intronic
1076717599 10:132374347-132374369 AGGGCTCCTGTGCTTGGAGTGGG + Intronic
1077048913 11:558048-558070 AGAGGGCCTGTGGTTGGTGGTGG + Intronic
1078481361 11:11678759-11678781 ACTGCCCCTGCCCTTGGTGGTGG - Intergenic
1081198799 11:40192745-40192767 AGGAAGCTTGAGCTTGGTGGGGG + Intronic
1081700060 11:45147039-45147061 ACGGCGCCGGCGCGGGGTGGGGG + Intronic
1083724881 11:64622902-64622924 GGGTCACCTGCGCCTGGTGGGGG - Exonic
1083741255 11:64712782-64712804 AGGGCGCGTGGGGTTGGCGGTGG - Intronic
1083901943 11:65647437-65647459 AGGCCGCCTGGGCTTCGAGGTGG + Exonic
1084222894 11:67695507-67695529 GGGGCGCCTCCCCTTGGTGGGGG + Intergenic
1085273844 11:75285760-75285782 AGGGTGCCTGCGTGTGTTGGGGG + Intronic
1091712229 12:2750185-2750207 AGGATGCTTGAGCTTGGTGGGGG - Intergenic
1091949505 12:4581154-4581176 AGAGAGCCTGTGCTTGCTGGGGG + Intronic
1098268313 12:68746061-68746083 AGCGCGCCTGCGCAGGGTAGCGG + Intergenic
1101269706 12:103130681-103130703 GGAGCTCCTGGGCTTGGTGGAGG - Intergenic
1101585423 12:106081531-106081553 AGGGTGCCTGTGCATGATGGAGG - Intronic
1102583353 12:113906437-113906459 AGAGTGGCTGCTCTTGGTGGGGG + Intronic
1102617525 12:114167600-114167622 AGGGAGACTGAGCTTGGTTGTGG + Intergenic
1104979388 12:132567015-132567037 AGGGCGCCTGTGCTGGGCAGTGG + Intronic
1105431303 13:20339919-20339941 TAGGAGCCTGGGCTTGGTGGCGG + Intergenic
1108153786 13:47564225-47564247 GGGATGCCTGAGCTTGGTGGGGG + Intergenic
1112509667 13:99997991-99998013 AGGGGCCCTGGGCTGGGTGGGGG - Intergenic
1113352598 13:109544148-109544170 AGGGCACCTGCGCATGGTCTTGG - Intergenic
1117957216 14:61131911-61131933 AGGGCGGGTGGGCTTGGTGCCGG - Intergenic
1118910045 14:70054239-70054261 AAGGCGCCTGAGCTTGGGGGTGG + Intronic
1119773605 14:77235945-77235967 AGGGGGACTGCGGTGGGTGGTGG + Intronic
1122908687 14:104815776-104815798 CGGGCGCCTGCTCGTGGCGGCGG + Intergenic
1123804267 15:23854954-23854976 TGGGCCCCTGCCCTTGGTGCAGG + Intergenic
1124350834 15:28954530-28954552 GGGGTGCCTGTGCATGGTGGGGG - Intronic
1125642794 15:41245329-41245351 TGGGCGCCTGTGCGTGGTGGTGG + Intronic
1126906763 15:53376163-53376185 AGGTCGCCTAAGCTTGGTAGGGG + Intergenic
1127687602 15:61364377-61364399 AGGGCTGCTGCGTTTGCTGGGGG + Intergenic
1128061722 15:64739580-64739602 TGGGGGCCTGCTCTTGGTGTAGG + Intergenic
1132096416 15:98988282-98988304 AGGACCCTTGAGCTTGGTGGGGG + Intronic
1133287148 16:4695902-4695924 AGGCCCCCTGCCCTAGGTGGGGG + Intergenic
1133737701 16:8628521-8628543 ATGGCGGCTGCTCTTGGTGGTGG + Intronic
1139632276 16:68237785-68237807 AGGGCGCCTGCGCTTGGTGGAGG + Intronic
1141840102 16:86568514-86568536 GCGGCGCCTGCGGGTGGTGGTGG - Exonic
1142903960 17:3030798-3030820 AGGGTGCCTGGTCCTGGTGGAGG + Intronic
1143387995 17:6543468-6543490 AGGGCTCCTGAGCATGGGGGAGG - Intronic
1144870036 17:18363599-18363621 AGCGCGGGTGCGTTTGGTGGCGG - Intergenic
1144998287 17:19285908-19285930 AGGGCTCCTGGGCCTGCTGGAGG - Intronic
1145197642 17:20908663-20908685 AGCGCGCCTGCGCGTGGGGGGGG - Intergenic
1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG + Intergenic
1145316612 17:21738909-21738931 CAGGCTTCTGCGCTTGGTGGTGG - Intergenic
1148748778 17:49932586-49932608 AGGGCGCCTGCTCCTGGGGGGGG + Intergenic
1149970279 17:61211046-61211068 AGGGTCCCAGCGCTGGGTGGGGG + Intronic
1151402582 17:73865480-73865502 TGGGCGCCTGTGCTGGGAGGAGG - Intergenic
1151848281 17:76673390-76673412 GGGTCACCTGCGCCTGGTGGAGG - Exonic
1152186206 17:78857708-78857730 AGCGCCCCTGCGCCGGGTGGAGG - Intronic
1153947622 18:10031405-10031427 AGGACGCCTGCGCCTGCTTGGGG - Intergenic
1154452370 18:14488046-14488068 AAGGCGGCCGGGCTTGGTGGCGG + Intergenic
1160968237 19:1755899-1755921 AGGGCCCCTGGCCTAGGTGGGGG + Intronic
1161915389 19:7224520-7224542 AAGTCGCCTGGGCTTCGTGGAGG - Intronic
1164700215 19:30279698-30279720 AGAGAGCCTGCTCTTGGTAGAGG + Intronic
1164781397 19:30896460-30896482 AGGCAGCCTGGGCATGGTGGTGG - Intergenic
1165838007 19:38771067-38771089 GGCGCGCGTGCGCCTGGTGGAGG - Exonic
1165841558 19:38791630-38791652 GGCGCGCGTGCGCCTGGTGGAGG + Exonic
1166752980 19:45173543-45173565 AGGGACCCTGTGCTTGGTAGAGG - Intronic
1168333120 19:55580864-55580886 GGGGGGCCTGAGCGTGGTGGGGG + Intergenic
1168435566 19:56314580-56314602 AGGGCGCATGCGCCTGGGGCGGG - Intronic
1168497395 19:56864909-56864931 AGTGCGCATGCGCTTCGTGCAGG + Intergenic
1202703676 1_KI270713v1_random:5502-5524 AGGGAGCCAGCCTTTGGTGGTGG - Intergenic
926132183 2:10310603-10310625 AGAGACCCTGAGCTTGGTGGTGG + Intronic
926243319 2:11104547-11104569 TGGGCACCTGCACCTGGTGGCGG + Intergenic
927698154 2:25251599-25251621 AGGCCGCATGGGCTTGGGGGCGG - Intronic
928750651 2:34466804-34466826 GGGATGCCTGGGCTTGGTGGGGG + Intergenic
933796118 2:85921111-85921133 AGGGCTGCCGGGCTTGGTGGAGG + Intergenic
938144741 2:128823981-128824003 GGGATGCCTGAGCTTGGTGGGGG + Intergenic
938145898 2:128834836-128834858 AGGGCACCTGAGCTGGGAGGAGG - Intergenic
939153804 2:138501756-138501778 AGGGCGCGTGCGCGCGGCGGCGG - Intergenic
939786438 2:146519706-146519728 AGGGTGCCTGCTTTTGGTGGAGG - Intergenic
944616969 2:201470991-201471013 AGGGGGCCAGCGTCTGGTGGCGG - Intronic
944780833 2:203015043-203015065 AGGGCCCCGGTGCTTGGTGGTGG + Intronic
945213415 2:207407953-207407975 AGCGAGCCTGTGCTTGGTTGAGG - Intergenic
946373310 2:219293839-219293861 TGGGCCCCTGCCCTTGGTAGTGG + Intronic
948923749 2:241081104-241081126 AGGCCGCCTGGGCTGGCTGGGGG + Intronic
1170916312 20:20629541-20629563 AGAGCGCCTGAGCTGGATGGTGG - Exonic
1172787429 20:37478408-37478430 AGGGTGTCTGGGCTTGGTTGGGG + Intergenic
1173576008 20:44113342-44113364 ACGGTGCCTGTGCTGGGTGGCGG - Exonic
1175065722 20:56285934-56285956 AGGGTCCCTGTGCCTGGTGGTGG - Intergenic
1175257865 20:57657801-57657823 GGGACGCCTGGGGTTGGTGGTGG - Intronic
1176030005 20:63007221-63007243 GGGACGCGTGCGTTTGGTGGCGG - Intergenic
1176213921 20:63939395-63939417 TGGGGGCCTGCGCTTGGAGGCGG - Intergenic
1176237320 20:64059636-64059658 AGGGCCCCAGCCCCTGGTGGGGG + Intronic
1176255045 20:64147294-64147316 AGGGAGGCTGCGGCTGGTGGGGG - Intergenic
1176274328 20:64255370-64255392 AGGGCGGCTGTGCTTGGTGCTGG + Intergenic
1178052426 21:28762772-28762794 ATGGCACCTGCACTTGGTGAAGG - Intergenic
1181394438 22:22609499-22609521 AAGGGGCATGCCCTTGGTGGAGG - Intergenic
1185368545 22:50447902-50447924 AGGGCGCCTGCCCTGTGTAGGGG - Intronic
950650346 3:14403045-14403067 AGGGCTCCGGCTCTTGGTGCGGG + Intronic
954118078 3:48478260-48478282 AGGGCTCCTGTGCGTGGAGGAGG - Intronic
954374636 3:50187903-50187925 GGGGGGCCTGCGCCTGGGGGTGG - Exonic
955392418 3:58531187-58531209 AGGGGACCTGCGCTTTGTGCAGG - Intronic
962634776 3:137319434-137319456 GGGACGCTTGAGCTTGGTGGGGG - Intergenic
966493726 3:180556584-180556606 AGGATGCCTGAGTTTGGTGGGGG + Intergenic
966531837 3:180989705-180989727 AGGGCGCCTGTGCTTGAGGTTGG - Exonic
968494967 4:910411-910433 AGGGGCCCTGTGCTTAGTGGAGG - Intronic
968703549 4:2067638-2067660 CTGGCGCCTGGGCTTTGTGGGGG + Exonic
968751376 4:2391078-2391100 AGGGCGCTTGGGGTTGGGGGAGG - Intronic
968919914 4:3517146-3517168 AGGGAGCCTGGGTTTGGGGGTGG + Intronic
969568382 4:7993350-7993372 AGGCCCCATGTGCTTGGTGGTGG - Intronic
976778944 4:88737526-88737548 AGGGCTTCTCCGCTTGCTGGAGG + Exonic
980100311 4:128535711-128535733 GGGACGCTTGAGCTTGGTGGGGG - Intergenic
982673094 4:158346006-158346028 AGGGAACATGCCCTTGGTGGTGG - Intronic
990164331 5:52977759-52977781 TGGGAGCTTGAGCTTGGTGGGGG - Intergenic
992564630 5:77985479-77985501 AGGGGGCATGCGGGTGGTGGTGG + Intergenic
999244180 5:150144609-150144631 AGAGTGCCTGTGCTTGGGGGTGG + Intronic
1001260234 5:170222245-170222267 ATGGGGCCTGGCCTTGGTGGAGG + Intergenic
1002591310 5:180292746-180292768 GAGGAGACTGCGCTTGGTGGCGG + Intergenic
1002944806 6:1750865-1750887 GGGATGCCAGCGCTTGGTGGGGG + Intronic
1003402649 6:5803529-5803551 GGGCAGCCTGGGCTTGGTGGGGG + Intergenic
1006449189 6:34096220-34096242 AGGACGCCTGTGCTTGGTCAGGG - Intronic
1008921972 6:56851674-56851696 AGGGCGGCGGTGGTTGGTGGGGG - Intronic
1009777104 6:68218802-68218824 GGGGTGCTTGAGCTTGGTGGGGG - Intergenic
1013643713 6:112114084-112114106 AGGGAGCCTGTGTTTGTTGGAGG - Exonic
1014549872 6:122778421-122778443 AGGCCTCCTACGCTAGGTGGCGG - Intergenic
1015773364 6:136791462-136791484 AGGGCTCCAGCGCTGGGCGGTGG + Intronic
1016431984 6:143994999-143995021 AGGGTGCCTGCTCTTTGTGATGG - Intronic
1019347331 7:537556-537578 AGGGGGCCTGGGTGTGGTGGAGG + Intergenic
1021099526 7:16571988-16572010 GGGTCGCCCGAGCTTGGTGGGGG + Intronic
1024658508 7:51472299-51472321 AGGGCCCCTGTGCTGGGAGGAGG + Intergenic
1025605671 7:63038374-63038396 AGGGCACCTGCGATTGGTAGGGG + Intergenic
1027235545 7:76295583-76295605 AGGGGGCCAGGGCTGGGTGGCGG - Intergenic
1029114222 7:98229126-98229148 AGGCCACCTGCGGATGGTGGAGG - Exonic
1029483324 7:100825454-100825476 AGGGAGCCTGCGCTTGCTCTGGG - Intronic
1029845252 7:103406026-103406048 GGGACGCTTGAGCTTGGTGGGGG - Intronic
1032468810 7:132163595-132163617 AGGGAGCCTGACCTTGATGGAGG + Intronic
1034882154 7:154770941-154770963 AAGACCCCTGGGCTTGGTGGAGG + Intronic
1034983898 7:155495985-155496007 AGCGCGCATGGACTTGGTGGTGG - Intronic
1035243657 7:157548550-157548572 CCGGGGCCTGCGCTTTGTGGAGG - Intronic
1035271142 7:157720641-157720663 AGGGCACCTGCTCCTGGTGTGGG - Intronic
1036779282 8:11634610-11634632 AGGGCACCTGCGATTGGTAGGGG - Intergenic
1039284564 8:36026669-36026691 GGGACGCTTGAGCTTGGTGGGGG + Intergenic
1039413579 8:37375451-37375473 AGGGGGCCTGGGGGTGGTGGAGG - Intergenic
1039580956 8:38666579-38666601 AAAGCCCCTGTGCTTGGTGGAGG - Intergenic
1046352610 8:113034520-113034542 AGTGCTCCTGCTGTTGGTGGTGG + Intronic
1046591858 8:116216337-116216359 AGGGGGGCTGGGCATGGTGGCGG - Intergenic
1049756978 8:144315116-144315138 AGGGGGCCTGCGCTGGGCAGTGG + Exonic
1052947439 9:34179345-34179367 AGGGCGCCGGAGCTAGGAGGTGG + Intronic
1054871739 9:70053486-70053508 ATGGTCCCTGCCCTTGGTGGCGG + Intronic
1057854298 9:98590765-98590787 TGGGCGCCTGAGCTAGGTAGGGG + Intronic
1058602476 9:106684912-106684934 AGAGTCCCTGGGCTTGGTGGAGG + Intergenic
1060528791 9:124335448-124335470 AGGGCTGCTGCGCTTGTTTGGGG + Intronic
1061385423 9:130286711-130286733 AGGGAACCTGCGGTGGGTGGAGG + Intronic
1062027984 9:134349332-134349354 GGGGCGCCTCGGCCTGGTGGAGG + Intronic
1062190178 9:135243914-135243936 GGGGCCCCTGTGCGTGGTGGGGG + Intergenic
1062429946 9:136522555-136522577 AGGGTGCCTGCACTGGGGGGAGG + Intronic
1186204958 X:7191518-7191540 AGAGCTCCTCCGCCTGGTGGAGG + Intergenic
1192128974 X:68530313-68530335 AGGATGCTTGAGCTTGGTGGAGG - Intronic
1194643393 X:96429400-96429422 GGGGTGCCCGAGCTTGGTGGGGG - Intergenic
1195068556 X:101258681-101258703 ACTGGGCCTGCGGTTGGTGGGGG + Intronic
1196284413 X:113863332-113863354 AGGGCTCCTGCGCTTTGCTGGGG + Intergenic