ID: 1139633951

View in Genome Browser
Species Human (GRCh38)
Location 16:68246720-68246742
Sequence TACTTGACACCCACCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139633951_1139633958 26 Left 1139633951 16:68246720-68246742 CCTGGATGGGTGGGTGTCAAGTA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1139633958 16:68246769-68246791 CTAAGGCCAGGAGAGAGTAATGG 0: 1
1: 0
2: 0
3: 28
4: 332
1139633951_1139633954 1 Left 1139633951 16:68246720-68246742 CCTGGATGGGTGGGTGTCAAGTA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1139633954 16:68246744-68246766 GGCTTCCTGGAGTATATAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1139633951_1139633959 27 Left 1139633951 16:68246720-68246742 CCTGGATGGGTGGGTGTCAAGTA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1139633959 16:68246770-68246792 TAAGGCCAGGAGAGAGTAATGGG 0: 1
1: 0
2: 0
3: 9
4: 235
1139633951_1139633957 14 Left 1139633951 16:68246720-68246742 CCTGGATGGGTGGGTGTCAAGTA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1139633957 16:68246757-68246779 ATATAGCTGGAGCTAAGGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 122
1139633951_1139633956 9 Left 1139633951 16:68246720-68246742 CCTGGATGGGTGGGTGTCAAGTA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1139633956 16:68246752-68246774 GGAGTATATAGCTGGAGCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139633951 Original CRISPR TACTTGACACCCACCCATCC AGG (reversed) Intronic
900592028 1:3464406-3464428 ACCTGGACACCCACCCAGCCAGG + Intronic
902710206 1:18234111-18234133 TGCTTGGCAGCCACTCATCCTGG + Intronic
907948386 1:59156630-59156652 TCCCTGAGTCCCACCCATCCTGG - Intergenic
908142829 1:61204913-61204935 TACTTGGCACCCACCATTCTAGG + Intronic
912523076 1:110259813-110259835 TACTAGAAACCCAACCATGCTGG - Intronic
917639134 1:176965321-176965343 TGGTAGACACCCAGCCATCCAGG + Intronic
1066649832 10:37643588-37643610 CACTTGACACCCACCCACAGAGG - Intergenic
1067032723 10:42889136-42889158 TGCTTGACACCCACCCACAGAGG - Intergenic
1067756970 10:49012554-49012576 CTCTTGATACCCAGCCATCCTGG - Intergenic
1068228486 10:54138047-54138069 AACCTGACACTCACCTATCCGGG - Intronic
1069822032 10:71234257-71234279 CACTTGACACCGCCCCCTCCAGG + Intronic
1071518725 10:86315876-86315898 CACTGGCCACCCACCCACCCAGG + Intronic
1072421417 10:95292760-95292782 TTCTTGGCACCCATTCATCCTGG + Intergenic
1074565480 10:114573684-114573706 TAGTCCACTCCCACCCATCCAGG + Intronic
1075332923 10:121586664-121586686 TACTTGACACACACTCTTCAAGG + Intronic
1076306256 10:129467408-129467430 GCCCTGACCCCCACCCATCCCGG + Intronic
1078867009 11:15307380-15307402 TACTTGAGACCATCCAATCCAGG - Intergenic
1081899645 11:46617152-46617174 CACTTCCCACCCACCCAGCCGGG + Exonic
1084973423 11:72783534-72783556 TACTTGATACCCACACTGCCTGG + Intronic
1087923703 11:103895615-103895637 CACTTGACCCCCAGCCAGCCTGG - Intergenic
1091600018 12:1912417-1912439 TACTGGACATCCACCAAGCCTGG - Intronic
1092248704 12:6879278-6879300 AACTTGTCATCCACCCAACCTGG + Intronic
1094035568 12:26066777-26066799 TCCTTGGGACCCACCCAGCCTGG + Intronic
1095875793 12:47079428-47079450 TACTTAGCAACCACCCATCCAGG + Intronic
1096741937 12:53699810-53699832 TCCTTGGCACCCTCCCCTCCTGG - Intergenic
1097442411 12:59626617-59626639 CATTTGCCAGCCACCCATCCTGG + Intronic
1107689035 13:42933637-42933659 TACATGATACCCACACCTCCTGG - Intronic
1112102887 13:96209660-96209682 CTCATGCCACCCACCCATCCAGG + Intronic
1116986452 14:51224767-51224789 TACCTTCCACCCACCCTTCCTGG - Intergenic
1117759234 14:59009451-59009473 TTCTTTGCACCCACCCATTCTGG - Intergenic
1118021359 14:61718465-61718487 TGCTAGATACCCCCCCATCCTGG + Intronic
1119069597 14:71569322-71569344 TACTTGGGACCCTCCAATCCTGG - Intronic
1119691308 14:76674804-76674826 TTCTTGAGATCCACCCAGCCTGG - Intergenic
1120576775 14:86191564-86191586 TACTTGAGACCCAATTATCCAGG + Intergenic
1121782239 14:96629417-96629439 AACTTGACAGCCATCCATACAGG + Intergenic
1124641586 15:31399551-31399573 TCCTTGACACCCACTGCTCCAGG + Intronic
1124721710 15:32116382-32116404 GACTTGTTACCCACCCATCAAGG - Intronic
1126352798 15:47762610-47762632 TACTTGCCATCTACCCATCTTGG + Intronic
1129255110 15:74330002-74330024 GACTTGATCCTCACCCATCCTGG - Intronic
1134337206 16:13311521-13311543 TACTTGAAACCCACCAAGGCTGG - Intergenic
1139633951 16:68246720-68246742 TACTTGACACCCACCCATCCAGG - Intronic
1150729224 17:67677470-67677492 TACTAGATACCCACCCACACTGG - Intronic
1150803937 17:68303888-68303910 TTCTTCACACCCACACCTCCAGG - Intronic
1158313537 18:56185379-56185401 TACTTGACACCCCCACATGGAGG - Intergenic
1160619907 18:80163502-80163524 CAGTTCACAGCCACCCATCCCGG + Intronic
1168554319 19:57325508-57325530 GGCTTGACACCCACCAACCCAGG - Intronic
925357197 2:3250192-3250214 CACTTGACTCCAACCCATGCAGG + Intronic
932000290 2:67878704-67878726 TACTTGACCTACACACATCCAGG + Intergenic
934696007 2:96400605-96400627 TACTTGCCCCCCACCAATGCTGG + Intergenic
936933868 2:117818934-117818956 TACCTGACGGCCACCCTTCCAGG - Intronic
937579968 2:123473484-123473506 AACTTGAGACCTACCCATCTAGG + Intergenic
942305552 2:174603722-174603744 TATTTGACTCTCACCCATCTTGG - Intronic
944416869 2:199487787-199487809 TAGTTCTCACCCACACATCCAGG - Intergenic
946944209 2:224802925-224802947 TCCTTGGCCTCCACCCATCCAGG - Intronic
948640796 2:239375006-239375028 TAGCTCACACCCACCCGTCCAGG - Intronic
1172018861 20:31898543-31898565 TCCTTCACTTCCACCCATCCTGG - Exonic
1173823440 20:46032468-46032490 TACTTGGTGCCCACCCAGCCGGG - Intronic
1176309742 21:5143131-5143153 TACTTGACAGCCACCCACTGGGG - Intronic
1179847316 21:44118902-44118924 TACTTGACAGCCACCCACTGGGG + Intronic
1181406589 22:22689351-22689373 TACTTGGCCCCCACCTACCCTGG + Intergenic
1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG + Intergenic
1184466394 22:44670824-44670846 TTCTCGTCACCCACCCCTCCTGG - Intronic
950312050 3:11967301-11967323 TAGATGACACCCACCCATATTGG - Intergenic
955112912 3:55966810-55966832 TACATGACTCCCACCCACCATGG + Intronic
961083134 3:124043457-124043479 AACTTGAGATCCACCCCTCCAGG - Intergenic
961107288 3:124252847-124252869 TTCTGGATACCCAGCCATCCAGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
964598195 3:158462104-158462126 TACTTGACCCCCAAATATCCTGG + Intronic
965762955 3:172099556-172099578 GACTTGACACCCATAAATCCAGG - Intronic
971198702 4:24492605-24492627 TCATTCACACCCACCCGTCCAGG - Intergenic
973584540 4:52377259-52377281 TTCTAGTCACCCACCCATCCTGG - Intergenic
974202914 4:58663974-58663996 CACTTCCCACCCACCCACCCAGG + Intergenic
974203252 4:58668014-58668036 CACTTCCCACCCACCCACCCAGG - Intergenic
980909139 4:138978136-138978158 TTCCAGACCCCCACCCATCCAGG + Intergenic
987255639 5:16148009-16148031 TACATGACACCAACACATCATGG + Intronic
987632558 5:20493791-20493813 CACTTTGCATCCACCCATCCTGG - Intronic
988917063 5:35905186-35905208 TTCATGCCTCCCACCCATCCTGG + Intronic
989970870 5:50522106-50522128 CACCTGACACCCACCCATGGAGG - Intergenic
991214314 5:64144667-64144689 TACTTGACAGCCACAGCTCCTGG - Intergenic
1000651443 5:163822747-163822769 TACCTGACACCCACCCACAGGGG - Intergenic
1003673551 6:8181837-8181859 TACTTGAAATCCAACCATCCTGG - Intergenic
1006934854 6:37710210-37710232 TTAATGACACCCACCCAGCCAGG + Intergenic
1015733112 6:136368172-136368194 TACTTAACACCCTCCCAACCAGG + Intronic
1019518563 7:1450388-1450410 TCCTTCACAGCCCCCCATCCTGG - Intronic
1024010085 7:45259709-45259731 TGGTTCACACCCACCCTTCCAGG + Intergenic
1025246497 7:57321505-57321527 TACTTGTCACCCAGCCTTCCAGG - Intergenic
1026811026 7:73465129-73465151 TTCTGGACACCCACCCATCTGGG + Intronic
1028116605 7:87004221-87004243 TTGTTGTCCCCCACCCATCCAGG - Intronic
1036179073 8:6567686-6567708 TACTGGACACCCACAACTCCAGG - Intronic
1039211787 8:35224886-35224908 AACTTGACACACACACAGCCTGG - Intergenic
1039236082 8:35504039-35504061 TACCTCTCACCCACCCTTCCAGG - Intronic
1040375131 8:46817544-46817566 TACTGGACAAACACCCACCCAGG + Intergenic
1045824875 8:106385544-106385566 TACTTTACACCCCACCAACCTGG + Intronic
1048111162 8:131470496-131470518 GACTTGGCATCCACCCATCTTGG - Intergenic
1048824815 8:138413879-138413901 TGCTTGTCACCCACCCCCCCAGG - Intronic
1049362112 8:142216774-142216796 TACTTGGCACCGACCCTGCCTGG + Intronic
1051587806 9:18745878-18745900 TATTTGACTCCCAGCCATCCTGG + Intronic
1055734807 9:79315280-79315302 TACTCGACATCCACCCAGCATGG - Intergenic
1061649008 9:132031081-132031103 TACTTGACACCTGGCCTTCCAGG - Intronic
1187025861 X:15434549-15434571 AACTTGACATCCACCCACACTGG - Intronic