ID: 1139636211

View in Genome Browser
Species Human (GRCh38)
Location 16:68260067-68260089
Sequence TACCCAGAGGTCCCAGGGAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139636199_1139636211 21 Left 1139636199 16:68260023-68260045 CCCCGCAGCCTTCCTATGAGGGA 0: 1
1: 0
2: 5
3: 9
4: 143
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194
1139636200_1139636211 20 Left 1139636200 16:68260024-68260046 CCCGCAGCCTTCCTATGAGGGAT 0: 1
1: 0
2: 0
3: 17
4: 124
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194
1139636205_1139636211 9 Left 1139636205 16:68260035-68260057 CCTATGAGGGATGTTACTGGGCT 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194
1139636195_1139636211 27 Left 1139636195 16:68260017-68260039 CCCTGGCCCCGCAGCCTTCCTAT 0: 1
1: 0
2: 1
3: 7
4: 165
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194
1139636202_1139636211 13 Left 1139636202 16:68260031-68260053 CCTTCCTATGAGGGATGTTACTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194
1139636196_1139636211 26 Left 1139636196 16:68260018-68260040 CCTGGCCCCGCAGCCTTCCTATG 0: 1
1: 0
2: 0
3: 21
4: 213
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194
1139636201_1139636211 19 Left 1139636201 16:68260025-68260047 CCGCAGCCTTCCTATGAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 181
Right 1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG 0: 1
1: 0
2: 2
3: 26
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139636211 Original CRISPR TACCCAGAGGTCCCAGGGAT CGG Exonic
900410604 1:2510896-2510918 GCCCCAGAGATGCCAGGGATGGG + Intronic
900468838 1:2840667-2840689 GTCCCAGAGGTCCCAGAGGTCGG - Intergenic
900751855 1:4402911-4402933 TGCCCAGATGCCCCAGGGATGGG - Intergenic
901540328 1:9910977-9910999 AGCCCAGAGAGCCCAGGGATGGG + Intergenic
902613439 1:17610325-17610347 CCCCCAGAGGTCCCAGGGCCAGG - Intronic
903277583 1:22231705-22231727 AACCCAGACATCCCAGGGTTGGG - Intergenic
904216434 1:28924038-28924060 TAGCTAGTGGTCCCAGGGAGAGG - Intronic
905307810 1:37031689-37031711 AACCCTGAGATCCCAGGGATGGG + Intronic
906580794 1:46933999-46934021 TACCCACCGGTGCCAGGCATTGG - Exonic
906602930 1:47144895-47144917 TACCCACCGGTGCCAGGCATTGG + Exonic
907185397 1:52605216-52605238 TAGCCAGTGGCCCCAGGCATGGG + Intronic
907400692 1:54223199-54223221 TACCCAGTGAGCCCAGGGCTGGG + Intronic
907545689 1:55258150-55258172 TAACCAGACTTCCCAGGGAGGGG - Intergenic
915121060 1:153629736-153629758 GAGCCAGAGTTCCCAGGGAGTGG - Intronic
915507687 1:156367896-156367918 GCCGCAGAGGCCCCAGGGATAGG - Intergenic
915737646 1:158094926-158094948 TACCCAGCTGCCCCAGGGAAGGG - Exonic
916471103 1:165123610-165123632 AACCCTGTGGTCACAGGGATTGG - Intergenic
917615633 1:176741031-176741053 TACTCAGACCTCACAGGGATGGG + Intronic
918173564 1:182022365-182022387 TACCCAGCTCTGCCAGGGATGGG - Intergenic
919067186 1:192707461-192707483 TACTCTGAGGTACTAGGGATTGG - Intergenic
919752864 1:201048979-201049001 TAACCAGAGCTGCCAGGGATGGG - Intronic
922986543 1:229870302-229870324 GACCCAGAGGGCCCATGGATGGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924919940 1:248618288-248618310 TACCCAAAGGGCTCTGGGATTGG + Intergenic
1063133678 10:3198796-3198818 TAATCTGAGGTCCCAGGGGTTGG - Intergenic
1063526673 10:6793192-6793214 TAGCAAGAGGTACCAGTGATGGG + Intergenic
1064302949 10:14138968-14138990 GGTCCAGAGGTCCCAGGGAAGGG - Intronic
1065468749 10:26054536-26054558 TATTCACAGATCCCAGGGATTGG - Intronic
1070421701 10:76243835-76243857 CATTCACAGGTCCCAGGGATAGG - Intronic
1071228468 10:83559196-83559218 TATCCTGAGGCCTCAGGGATGGG - Intergenic
1071461703 10:85902985-85903007 GCCCCAGAGGTGCCAGGGTTTGG + Intronic
1073008514 10:100342376-100342398 TACCCCAGGGCCCCAGGGATAGG + Intergenic
1073077808 10:100835705-100835727 TGCCCAGAGGTCTCTGGGGTGGG + Intergenic
1073513119 10:104054815-104054837 CAGCCAAAGGTCCCTGGGATTGG + Intronic
1074722426 10:116274123-116274145 GAACCAGCGGTCCCAGGGGTTGG - Intergenic
1076359761 10:129879235-129879257 AACCAAGAGGTCCCAGAGCTTGG + Intronic
1076481605 10:130788736-130788758 TATTCACAGGTACCAGGGATAGG - Intergenic
1077802239 11:5551658-5551680 TCCCAAGGGGTCCCAGTGATAGG - Intronic
1078117113 11:8464592-8464614 CACCCTGAGGTCCCAGGCCTGGG - Intronic
1081717491 11:45260796-45260818 CAGCCAAAGGTCCCAGGGACAGG - Intronic
1082027884 11:47586101-47586123 AAACAAGAGGTCCCAGGGCTGGG + Intergenic
1083652645 11:64212097-64212119 TTCCCAGAGCTCCCAGGCTTGGG - Intronic
1083735420 11:64677537-64677559 AACCCAGGGGACCAAGGGATGGG - Intronic
1084220354 11:67674155-67674177 TCCCCAGGAGCCCCAGGGATGGG - Intronic
1084428098 11:69096556-69096578 CACCCAGAGGTACCAGGGGGTGG - Intergenic
1085561543 11:77476444-77476466 TATTCATAGTTCCCAGGGATTGG - Intergenic
1085701158 11:78747258-78747280 GACCCAGATGTGGCAGGGATGGG + Intronic
1087936246 11:104037185-104037207 TGCCCAGCGGTCACAGGGCTTGG + Exonic
1087977601 11:104569034-104569056 TACCCAGAGGTCAGAGGCAAAGG - Intergenic
1090928585 11:131275137-131275159 GACCCAGAGGTCCCACAGCTAGG + Intergenic
1093518212 12:20016178-20016200 TTCCCAGAGGTACCAAGAATAGG + Intergenic
1093582391 12:20797705-20797727 TATCCACAGGTTCCAGGGATTGG + Intergenic
1094034089 12:26048269-26048291 TACCTAGAGATGTCAGGGATGGG - Intronic
1100302023 12:93316362-93316384 GACTGAGAGCTCCCAGGGATAGG + Intergenic
1101976086 12:109360046-109360068 AAGCAAGAGGTCCCAGGAATGGG + Intronic
1102614619 12:114142503-114142525 GTCCCAGAGGTCCTAGGGAGAGG + Intergenic
1103561767 12:121796579-121796601 CTCCCTGAGGTCCCAGGGACGGG + Intronic
1106672981 13:31927378-31927400 AAGCCAGAGTTCCCAGGGAGAGG + Intergenic
1106920847 13:34561757-34561779 TGTCCACAGATCCCAGGGATTGG - Intergenic
1107771498 13:43791906-43791928 TGCCCAGTGATCCCAGGGAAAGG - Intergenic
1113968297 13:114167154-114167176 CACCATGAGGTCCCAGGGAGGGG + Intergenic
1114534208 14:23412691-23412713 TGCCCTGAGGACCCGGGGATGGG - Intergenic
1115586278 14:34816714-34816736 TAGCCAGATGTGCCAGGTATAGG - Intronic
1117162719 14:53005201-53005223 TAATCAGAGGCCCAAGGGATGGG + Intergenic
1119451175 14:74712290-74712312 CACCCAGAGGGTCCACGGATGGG + Intronic
1119666986 14:76491777-76491799 TGCCCACAGGCCCCAGGGATGGG - Intronic
1119859256 14:77924626-77924648 ACCCCAGAGGCCCCAGGGCTGGG - Intronic
1120156108 14:81095204-81095226 AGCCCAGAGGTCCCAAGGCTGGG + Intronic
1120781563 14:88490413-88490435 TACCCAGAGGTCCCACTGTTTGG + Intronic
1120999313 14:90440090-90440112 CACCCAGAGGCCCCAGGCCTGGG - Intergenic
1122769307 14:104090819-104090841 CACCCACAGGTACCGGGGATTGG + Intronic
1122941773 14:104984735-104984757 TACCCAGAGGAGGCAGTGATGGG + Intergenic
1124689739 15:31812014-31812036 CACCCAGCCTTCCCAGGGATGGG + Intronic
1126662908 15:51049587-51049609 GCATCAGAGGTCCCAGGGATGGG - Intergenic
1128383313 15:67129127-67129149 TTCCCAGGGGTCCCAGGGGTTGG - Intronic
1129373090 15:75110065-75110087 CAACCAGAGGTCCCTGGGCTGGG + Intronic
1132299887 15:100768844-100768866 GAGCCAGAGGTGCCAGGGGTGGG + Intergenic
1132655051 16:1038326-1038348 TCCCCAGAGGTCCCAGCCCTTGG - Intergenic
1133386990 16:5377680-5377702 GACCTAGAGGTCCCAGGGGAAGG + Intergenic
1133493391 16:6293770-6293792 TAACCAGAGGGTCCAGGAATAGG + Intronic
1133795509 16:9043085-9043107 TAGTCAGAGGTCCCAGGCAGGGG - Intergenic
1134508290 16:14825117-14825139 GACCCGGTGGTCCCCGGGATTGG - Intronic
1137477745 16:48825152-48825174 CATGCACAGGTCCCAGGGATTGG - Intergenic
1137787982 16:51152626-51152648 TGCCCAGGGGTCCCAGGGACTGG - Intergenic
1139636211 16:68260067-68260089 TACCCAGAGGTCCCAGGGATCGG + Exonic
1141592113 16:85076332-85076354 TGCAGAGAGTTCCCAGGGATGGG + Intronic
1141775418 16:86119716-86119738 TACCCACAGGTCCCTGCTATTGG - Intergenic
1141996811 16:87641126-87641148 TGCCCAGAGGTCCCAGCACTGGG - Intronic
1142109975 16:88326057-88326079 AACCCAGAGGCCCCAGCAATGGG + Intergenic
1144158326 17:12530564-12530586 CATCCACAGGTTCCAGGGATTGG + Intergenic
1145317350 17:21742864-21742886 TACCCACAGGTCCAATGGAGAGG + Intergenic
1145890977 17:28415489-28415511 TACCCAGAGCTAACAAGGATGGG + Intergenic
1145903003 17:28500067-28500089 CAACCACAGGGCCCAGGGATAGG + Intronic
1145925610 17:28644796-28644818 TGGCCCGAGCTCCCAGGGATGGG - Intronic
1146949091 17:36893370-36893392 AGCCCAGAGCTCCCAGGGAATGG + Intergenic
1146949846 17:36898323-36898345 AGCCCAGAGCTCCCAGGGAATGG - Intergenic
1147879097 17:43642494-43642516 GACCCAGAGGTCCCAGGGCTAGG + Intronic
1148443981 17:47726796-47726818 CTCTCACAGGTCCCAGGGATAGG + Intergenic
1149467519 17:56891590-56891612 CCCCAAGAGGTCCCAAGGATTGG - Exonic
1150078426 17:62214230-62214252 GACCCAGAGGCCAGAGGGATGGG - Intergenic
1151191236 17:72399611-72399633 TAACCCGAGGGCCCAGTGATCGG + Intergenic
1152067251 17:78118668-78118690 GACCCAGAGGTCCCAAGGCTTGG + Intronic
1152106582 17:78332872-78332894 TACCCAGATGTCTCAGGACTGGG - Intergenic
1154430929 18:14307931-14307953 TATCCACAGTTCCCAGGAATTGG - Intergenic
1155391816 18:25346797-25346819 TCTCCAGAGGTCCCTGGTATGGG + Intronic
1156088383 18:33436935-33436957 GACCTAGAGGTCCCAGGCACAGG - Intronic
1156260108 18:35438622-35438644 GACACAGAGTTCCCAGGGCTGGG - Intergenic
1157565333 18:48675709-48675731 TTCCCAGGGGTCCCAGGGAGGGG - Intronic
1157748032 18:50153897-50153919 TGCCCAGAGGCTCCAGGGGTGGG - Intronic
1160665788 19:327574-327596 TACCCAGAGGTCACAGGTCAAGG - Intronic
1161671402 19:5613178-5613200 TTCCCAGAGGTCTGACGGATAGG - Intronic
1162797023 19:13092351-13092373 TCCCCACAGGTCCCAGAAATGGG - Intronic
1162910100 19:13843622-13843644 TTCCCAGAGGTCCCAGCGGGTGG - Intergenic
1167371561 19:49085680-49085702 TACCCAGAAGCCCCAGCGGTGGG + Intronic
1167705411 19:51078645-51078667 TACCCAGGGGGCACAGGGCTAGG + Intronic
928201425 2:29249965-29249987 TACCCTGAGGCCCCAGGGATGGG + Intronic
929166891 2:38891566-38891588 TAACCTGTGGTCCCAGGAATAGG - Intronic
931798638 2:65736739-65736761 TCCTGAGAGTTCCCAGGGATGGG - Intergenic
932602635 2:73139037-73139059 TCCCCAGAGGTCAAAGAGATGGG + Intronic
932885189 2:75542975-75542997 TTCCCTGTGGTTCCAGGGATGGG - Intronic
933161078 2:79025893-79025915 TACTGGGAGGTCTCAGGGATGGG + Intronic
933971603 2:87474198-87474220 TCCCAAGAGATCCCAGGGATGGG - Intergenic
934718127 2:96554890-96554912 TTCCCAGAGGCCCCAGGGCATGG - Intergenic
934753527 2:96809667-96809689 TACTCAGAGGTCCCTGGCAGAGG - Exonic
936286891 2:111187884-111187906 TCCCCAGAGGGACCAGGCATTGG - Intergenic
936322127 2:111476001-111476023 TCCCAAGAGATCCCAGGGATGGG + Intergenic
936520652 2:113210195-113210217 TACCCAAATGTCCCAAGGAAGGG - Intergenic
936896545 2:117434227-117434249 CACCCAGAGGTCCCAGGTCAGGG - Intergenic
938386812 2:130872551-130872573 TACCCAGTGGTCACGGGGACGGG - Intronic
939124932 2:138165951-138165973 TACCCATAAGTCCCATGGACTGG + Intergenic
943237839 2:185346030-185346052 TACCCATAAGGCCCAGGTATGGG - Intergenic
944905175 2:204255125-204255147 TCCCCAGAAGTCCCAGCGAACGG - Intergenic
946073303 2:217052956-217052978 TTACCAGAGGTTCAAGGGATAGG + Intergenic
947816293 2:233039872-233039894 CACCCAGATGTCCCAGGCAGTGG - Intergenic
948232423 2:236359819-236359841 GACCCAGAGGTCTCAGGAGTGGG - Intronic
948517264 2:238511607-238511629 TGCCCAGAAGTGCCAGGGATCGG - Intergenic
1169325664 20:4673557-4673579 TACTCACAGGTCCCAGAGACCGG + Intergenic
1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG + Intergenic
1173054133 20:39594999-39595021 ACCCCAGAGGTCCCAGGGAAAGG - Intergenic
1173150958 20:40566114-40566136 AACCCAGGGGACCCAGGCATGGG + Intergenic
1173498325 20:43534737-43534759 TTCTGACAGGTCCCAGGGATGGG + Intronic
1174511967 20:51060206-51060228 CACCCACAGGACCTAGGGATGGG + Intergenic
1176091358 20:63319926-63319948 TGACCCCAGGTCCCAGGGATGGG + Intronic
1176252182 20:64130688-64130710 CACGCAGATGTCCCAGGAATGGG + Intergenic
1179610172 21:42545151-42545173 TGGCCAGAGGACCCAGGGACAGG - Intronic
1179999631 21:44989458-44989480 AACCCAGAGAACACAGGGATGGG - Intergenic
1181282126 22:21727766-21727788 TACACAGGTGCCCCAGGGATGGG - Intronic
1182100127 22:27651735-27651757 TCCCCAGTGGACCCAGGGAGAGG + Intergenic
1182761223 22:32723829-32723851 TTGCCGGAGGCCCCAGGGATAGG + Intronic
1185093100 22:48786809-48786831 TGCCCAGAGGGGCCAGGGCTGGG - Intronic
950678032 3:14566297-14566319 GCCACAGAGCTCCCAGGGATGGG + Intergenic
953240005 3:41140496-41140518 TATCCAGAGGTCCCCGGGAGAGG + Intergenic
954422513 3:50426091-50426113 CTCCCAGAGCTCCCAGGGATTGG - Intronic
955122388 3:56073546-56073568 TAGCCTGGTGTCCCAGGGATTGG - Intronic
960281704 3:115787583-115787605 GACCCAGAAGTCCCAGAGATTGG + Intergenic
961369137 3:126418977-126418999 CACCCACAGGCCCCAGGGCTGGG - Intronic
962694504 3:137934546-137934568 TACCCAGAGGTTTCTGGGAATGG + Intergenic
963800729 3:149673762-149673784 TAACCAGAGAGGCCAGGGATGGG + Intronic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968935653 4:3608809-3608831 TACCCAGGGGTTCCAGGGGCAGG - Intergenic
969212196 4:5696445-5696467 CACCCAGTGGCCCCAGGGATAGG + Intronic
969222667 4:5771512-5771534 TGCTCAAAGGTTCCAGGGATTGG + Intronic
970805427 4:20024960-20024982 TCCCCAGAGACCCCAGAGATGGG + Intergenic
974387766 4:61225207-61225229 AATCCAGTGGTCCCAGGGACTGG + Intronic
976257007 4:83109828-83109850 GACCCAGGGGTCCCAGAGCTGGG - Intronic
976840986 4:89432115-89432137 TACCCATATGTTCCAGGGACAGG + Intergenic
978169363 4:105650645-105650667 TACTCACAGGTCCCAGAGAGAGG - Intronic
978971181 4:114807862-114807884 TACACTGAGGTCCCACGGGTTGG - Intergenic
981663409 4:147194305-147194327 CACCCAGCTGTCCCATGGATTGG + Intergenic
984530466 4:180909624-180909646 TACCCACAGGTCCCTGGAAGAGG - Intergenic
986728649 5:10618579-10618601 TACCAAGGGGTGCCAGGGAAGGG + Intronic
990874060 5:60464615-60464637 TTCCCACAGATCTCAGGGATGGG + Intronic
991951189 5:71948110-71948132 GACCCAAAGGGCCCAGGGAAAGG - Intergenic
995903186 5:117093720-117093742 TGCCCAGAATTCCCAGGCATAGG + Intergenic
996767224 5:127046631-127046653 TAGCCAGTTGGCCCAGGGATAGG + Exonic
997751235 5:136347852-136347874 CACTGAGAGGTCCCAGAGATAGG + Intronic
998855981 5:146395491-146395513 TACCCTGAGGAGTCAGGGATGGG + Intergenic
1001095114 5:168770087-168770109 TGCCAAGTGCTCCCAGGGATGGG + Intronic
1002766093 6:240250-240272 TACATAGAGGTCCCAGGGAGAGG - Intergenic
1004053837 6:12114283-12114305 TAACAAGAGGTCCCTGGGCTTGG - Intronic
1004249879 6:14015130-14015152 TACCCACAGTTCTCAAGGATGGG + Intergenic
1004345575 6:14846257-14846279 CATGCACAGGTCCCAGGGATTGG - Intergenic
1006314539 6:33282454-33282476 TACCCAGGGGTCCCATAGATGGG - Intronic
1006449677 6:34098891-34098913 TGCCCAGAGGTGCAAGAGATGGG + Intronic
1013183996 6:107741526-107741548 TAAGCAGAGTTCCCAGGGCTGGG - Intronic
1016986605 6:149900214-149900236 AACACAGAGGTTCCAGGGACTGG + Intergenic
1018383839 6:163285109-163285131 GGCCCTGAGGTCCCTGGGATGGG - Intronic
1020501078 7:8921217-8921239 TACAAAGAGCTCCCAGGGAGTGG - Intergenic
1020568109 7:9822767-9822789 TACCCAGAGGTCCTAGGCCTGGG + Intergenic
1023999113 7:45179281-45179303 TCCCCAGAGCTTCCAGGGGTTGG - Intronic
1024527996 7:50365132-50365154 TCCACAGAGCTCCCAGTGATTGG + Intronic
1026434878 7:70387309-70387331 TACCTAGAGGTCTCAGGGAATGG - Intronic
1030632014 7:111906596-111906618 TACTCATAGGTTCCAGGGATTGG - Intronic
1032181271 7:129680970-129680992 TAGTCACAGGTTCCAGGGATGGG - Intronic
1033704809 7:143876302-143876324 TGGCCAAAGGTGCCAGGGATGGG + Exonic
1033856551 7:145568481-145568503 TATTCACAGGTCCCAGGGTTAGG + Intergenic
1035779378 8:2216039-2216061 ACCCCAGAGGACCCAGGGAAAGG + Intergenic
1037757303 8:21719275-21719297 TTCCCACAGGGCCCAGAGATGGG + Intronic
1039620361 8:38991732-38991754 TACTCATAGGTCCCAGAGACAGG + Intronic
1042841375 8:73127182-73127204 TACTCACAGGTTCCAGGTATTGG + Intergenic
1044613596 8:94118012-94118034 GACCGAGAGGTCTCAGGGGTAGG - Intergenic
1045047476 8:98293717-98293739 GACCCGGAGGTCCCAGGAACGGG + Intronic
1049312742 8:141942092-141942114 TGCCCAGAGCCCCCAGGGGTTGG - Intergenic
1049673615 8:143880231-143880253 TCCCCAGAGGTCACTGGGCTGGG - Intergenic
1051742453 9:20264991-20265013 GACCCAGATGTACCAGGGCTGGG - Intergenic
1053001091 9:34577757-34577779 CTTCCTGAGGTCCCAGGGATGGG - Intronic
1054454530 9:65423062-65423084 TACCCAGGGGTTCCAGGGGCAGG + Intergenic
1056186681 9:84141920-84141942 TAGTCACAGGTTCCAGGGATTGG - Intergenic
1058998579 9:110324690-110324712 TACCGAAAGTTCCCAGGAATGGG + Intronic
1060371161 9:123073128-123073150 TAAACAGAGGTCCCAGGATTTGG + Intronic
1060732005 9:126044682-126044704 ATTCCAGAGGTCCCAGGGAGGGG - Intergenic
1061321231 9:129831080-129831102 AACCCAGAGGCCTCAGGGAGGGG + Intronic
1061390730 9:130315807-130315829 CACCCATAGGTCCCAAGGAAAGG - Intronic
1062494039 9:136823200-136823222 TCACCAGGGGTCCCAGGGGTGGG + Intronic
1185620463 X:1450570-1450592 GACCCAGAGCCCCTAGGGATGGG - Intronic
1185993052 X:4913159-4913181 CATCCATAGGTTCCAGGGATTGG + Intergenic
1186633416 X:11376215-11376237 TATTCACAGGTTCCAGGGATGGG - Intronic
1188439978 X:30207220-30207242 TATCCAGAGGTCCCAGAACTAGG + Intergenic
1188447913 X:30276086-30276108 TACCCTGCAGTCACAGGGATTGG - Intergenic
1191681664 X:63846939-63846961 TACCAAAATGTCCCAGGGAAAGG + Intergenic
1192448036 X:71224821-71224843 TACCCAGTGGTCCCAGAGAGAGG - Exonic
1195687285 X:107598378-107598400 TACAGATAGATCCCAGGGATTGG + Intronic
1201683011 Y:16669909-16669931 TATCCATAGGTTCCAGGGATTGG - Intergenic