ID: 1139637119

View in Genome Browser
Species Human (GRCh38)
Location 16:68264515-68264537
Sequence CGCCGCCGCCGCGGCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 1, 2: 19, 3: 136, 4: 606}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139637119_1139637124 5 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637124 16:68264543-68264565 ACCGAGCATCCTGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1139637119_1139637129 14 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637129 16:68264552-68264574 CCTGGCGGCGCCGGGCCACTGGG 0: 1
1: 0
2: 1
3: 13
4: 143
1139637119_1139637122 -4 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637122 16:68264534-68264556 GGCGGCGCGACCGAGCATCCTGG 0: 1
1: 0
2: 1
3: 2
4: 31
1139637119_1139637134 28 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637134 16:68264566-68264588 GCCACTGGGAGGTAACGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 139
1139637119_1139637133 24 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637133 16:68264562-68264584 CCGGGCCACTGGGAGGTAACGGG 0: 1
1: 0
2: 0
3: 12
4: 125
1139637119_1139637131 23 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637131 16:68264561-68264583 GCCGGGCCACTGGGAGGTAACGG 0: 1
1: 0
2: 0
3: 10
4: 155
1139637119_1139637126 6 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637126 16:68264544-68264566 CCGAGCATCCTGGCGGCGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 89
1139637119_1139637130 17 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637130 16:68264555-68264577 GGCGGCGCCGGGCCACTGGGAGG 0: 1
1: 0
2: 1
3: 28
4: 264
1139637119_1139637123 -1 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637123 16:68264537-68264559 GGCGCGACCGAGCATCCTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 39
1139637119_1139637127 13 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637127 16:68264551-68264573 TCCTGGCGGCGCCGGGCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 111
1139637119_1139637136 29 Left 1139637119 16:68264515-68264537 CCTGAGCTGCCGCGGCGGCGGCG 0: 1
1: 1
2: 19
3: 136
4: 606
Right 1139637136 16:68264567-68264589 CCACTGGGAGGTAACGGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139637119 Original CRISPR CGCCGCCGCCGCGGCAGCTC AGG (reversed) Intronic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
900628966 1:3623893-3623915 CGCCTCCCACGCGGCAGCTGGGG - Intergenic
901002281 1:6154769-6154791 CGCCGCCGCCGCTGCTGCCGCGG + Exonic
901295070 1:8154892-8154914 CGGCGCCTCCGCGGCAGCTAAGG + Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901540116 1:9910178-9910200 CGCCGCCGCAGCGGCTGCTCGGG - Exonic
901629009 1:10639208-10639230 CGCCGCCGCCGCCGCAGCTGGGG - Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
902377175 1:16035284-16035306 CGCCGCCGATGCTGCAGCTCTGG + Intergenic
902382353 1:16058543-16058565 CGCCGCCGATGCTGCAGCTCTGG + Exonic
902400833 1:16155857-16155879 GGCCGCGGCCGCGGCGGCGCAGG - Exonic
902429548 1:16352439-16352461 CGCCGCAGCTGCTGCTGCTCAGG + Exonic
903115532 1:21176303-21176325 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903750212 1:25616799-25616821 CCCCGCCGCCGCCGCCGCTCGGG - Intergenic
903950658 1:26994227-26994249 CGCCGCCGCTCAGGCGGCTCAGG - Exonic
904036580 1:27562202-27562224 CGCCCCCGCCGAGCCAGCTTGGG - Intronic
904039295 1:27575175-27575197 CGCCGCCGCCGCCGCCTCTGGGG + Intronic
904585457 1:31577304-31577326 CGGCACGGCCGCGGCAGCACAGG - Exonic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904756145 1:32769960-32769982 GGCCGCCCCCGAGGCACCTCAGG + Exonic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905151355 1:35930754-35930776 CGGGGCCTCCGCGGCAGTTCGGG + Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905803793 1:40861948-40861970 CGCCGCCGCCCCGCCAACCCGGG - Exonic
905862636 1:41361483-41361505 TGCTGCCGCCGCCGCCGCTCCGG - Intergenic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906214290 1:44030281-44030303 CGCCGCCTCCACGCCAGCTTAGG - Intronic
906365422 1:45205978-45206000 CGCCGGCGCCGGGGCCGCCCCGG + Exonic
906480949 1:46198469-46198491 CGCCGCCGCCGCCGCTGCCGCGG + Intronic
906627019 1:47333813-47333835 CCCCGCCGCCGTGGCTGCCCGGG - Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907268463 1:53276731-53276753 CGCCGTCGCAGCGCCAGCCCAGG + Exonic
907429965 1:54406049-54406071 CGCCGCCGCCGCTACCGCTCCGG + Exonic
908293204 1:62688261-62688283 CGCCGTCGCCGCAGCAGCCATGG - Exonic
908355846 1:63324102-63324124 GGGCGCCGCCGCGGCCGCTGCGG + Exonic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
908780404 1:67685377-67685399 AGGCGCCGCTCCGGCAGCTCAGG - Exonic
908951584 1:69568287-69568309 CGCCGCCGCCGCTGCTGCTGCGG + Intergenic
910759003 1:90717598-90717620 CGCCGCCGCCGCCGCTGCCGGGG + Intergenic
912174683 1:107141229-107141251 CGCCGCCACCGCCGCAGCCCGGG - Intronic
912345883 1:108963160-108963182 AGCCGCCGGCGCGGGAGCTGAGG + Intronic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
915128002 1:153679170-153679192 CGCCGCTGCTGCTGCTGCTCCGG + Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915307400 1:154988504-154988526 AGCACCCGCCGCAGCAGCTCTGG - Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065508 1:161132647-161132669 CGCCGCCGCCGCCGCGGCCGTGG + Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
916792524 1:168136744-168136766 AGCGGCCGCCGCGGCAGCTCAGG + Intronic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
917846668 1:179025957-179025979 CGCCGCCGCCACAGCGGCTCCGG - Exonic
918064268 1:181089099-181089121 CGCCACCGCAGCAGCAGCCCGGG + Exonic
919712095 1:200738936-200738958 AGCCGCCGCCGCCGCCGCTGCGG - Intergenic
920912572 1:210232622-210232644 GGCCGCCGCCGCCGCTCCTCAGG - Intergenic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922958622 1:229626017-229626039 CGCCGCCCCCGCCGCCGCTCTGG + Exonic
923141332 1:231163149-231163171 CGCCGCCGCCGCTGCCTCTCTGG + Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
923372329 1:233327319-233327341 CGCCCCCGCCGCAGGTGCTCCGG - Intergenic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924415072 1:243850069-243850091 CGCCGCCGCCCGAGCAGCTGCGG - Intronic
924415209 1:243850443-243850465 CGCCGGCGGGGCGGCGGCTCTGG + Intronic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064086506 10:12349650-12349672 CGCCGCCGCCGCCGCGGCCGCGG - Exonic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443059 10:15370894-15370916 CGCCGCCTCCGCGCCAGGCCCGG + Intronic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064619588 10:17201640-17201662 CGCCTCAGCCGCCGCAGCCCCGG + Exonic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1064982009 10:21174343-21174365 CGCCACCGCCGCTGCAGGCCGGG + Intergenic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065099804 10:22321528-22321550 CGTGGCGGCCGCGGCTGCTCGGG + Exonic
1065549900 10:26860349-26860371 AGGCGGCGCGGCGGCAGCTCGGG + Intronic
1065883823 10:30059507-30059529 CGCCGCCACCGCCGCCGCTCCGG + Exonic
1066022770 10:31319576-31319598 CGCCGACGCCGCCGCATCCCCGG + Intronic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1067484540 10:46635495-46635517 CGCCGCCGCCGCGGTTGATGTGG - Intergenic
1067610219 10:47706152-47706174 CGCCGCCGCCGCGGTTGATGTGG + Intergenic
1071618176 10:87094978-87095000 CGCCTCCGCCGCGGCCTCCCCGG + Intronic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072283787 10:93894126-93894148 GGCGGCCGCCGAGGCAGCTGGGG + Exonic
1072680087 10:97499586-97499608 CGCCGCTGGCCTGGCAGCTCCGG + Intronic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072915525 10:99535457-99535479 CGCCGCCGCCGCCGCAGCAGCGG + Exonic
1072915527 10:99535460-99535482 CGCCGCCGCCGCAGCAGCGGCGG + Exonic
1073136724 10:101224496-101224518 CCCCGCGGGCGCCGCAGCTCGGG + Intergenic
1073414261 10:103368201-103368223 CGCCCCCGCCGGGGCAGCGGCGG - Exonic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074591966 10:114822001-114822023 CGCCGCCGCCGCCCCTGCTGCGG - Exonic
1074722015 10:116272200-116272222 CGCCGCCGGCGACTCAGCTCCGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074865724 10:117543429-117543451 CGCCGCCGCCGCCGCCGGTAGGG + Exonic
1075370124 10:121928308-121928330 CGCGGCGGCCGCGCCAACTCCGG + Intronic
1075519700 10:123136244-123136266 CGCCGCGGCAGCGGCAGCGGCGG - Exonic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1076116855 10:127907063-127907085 CGCCGCCTCGGCTCCAGCTCCGG - Exonic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076554249 10:131311678-131311700 CGCCGCCGGCCCAGCATCTCGGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076898573 10:133325920-133325942 CGCCGCCGCCGCCCCAGCCTGGG + Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1077922972 11:6655482-6655504 CGCCGCCGCTGCCGCAGCCCAGG + Intronic
1078210336 11:9265165-9265187 CGCCGCCGCTACCGCGGCTCGGG + Exonic
1078786563 11:14499815-14499837 AGCCGCCGCCGCCGCTGCTGCGG - Exonic
1079428217 11:20363835-20363857 CGCGGCGGCGGCGGCTGCTCTGG + Exonic
1079459769 11:20669503-20669525 CGCCGCCGCCGCGCCAGCGGTGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081700080 11:45147107-45147129 TGCCGCCGCCGCGGGAGCCGGGG + Intronic
1081832051 11:46121967-46121989 CGCCGCCGCCGCCGCTGCACTGG - Intergenic
1082029502 11:47594261-47594283 CGCCGCCCCTGCCGCAGCGCGGG - Exonic
1082816872 11:57514964-57514986 CGCCGCGGCCGCTGCAGCCTCGG + Intronic
1083572630 11:63768574-63768596 CGCCCCTGCCGCCGCTGCTCCGG + Exonic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083904827 11:65662768-65662790 CGCCACAGCCGCGGCGGCCCCGG + Intronic
1083945067 11:65919097-65919119 CGCGGCCGCTGCGGCCGCTGAGG - Exonic
1084129034 11:67119339-67119361 CGCCGCCGCCGCCGCTGCCGGGG - Intronic
1084151360 11:67289335-67289357 CGCCGCCGCCGCTACTGCTGCGG + Exonic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1087105052 11:94400330-94400352 TGCCACCGCCGCAGAAGCTCTGG + Intronic
1087138112 11:94740505-94740527 CGCCGCCGCCGCGCGCCCTCGGG + Intronic
1088462116 11:110093111-110093133 AGCGGCGGCCGCGGCAGCCCAGG + Intergenic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1091248932 11:134125175-134125197 CGCCGCCACCGCCGCTGCACGGG + Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1093464893 12:19439582-19439604 CGCCGACGCCGCTGCAGAGCAGG - Intronic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1094466036 12:30754767-30754789 GGCCGCCGCTGCCGCAGCCCGGG + Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095261743 12:40105952-40105974 AGCCGCCGCCACGGCCGCTCCGG + Intronic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1096191338 12:49622230-49622252 AGCCGCCGCCGCGGCAGGAGAGG - Intronic
1096593079 12:52675329-52675351 GGCGGCGGCGGCGGCAGCTCTGG - Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1099989765 12:89709325-89709347 CGCCGCCGCCGCTGCCGCCTTGG + Intergenic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1100315626 12:93441997-93442019 AGCCGCCGCCGAGGCCCCTCGGG + Exonic
1100565623 12:95790909-95790931 CGCCGCTGCCGCTGCCGCCCGGG + Intronic
1100869443 12:98894981-98895003 CGCCGCCGCCGCTGCCGCCAGGG - Intronic
1101253832 12:102958363-102958385 CGCTGCCGCTGCGGCGGCTGCGG - Exonic
1101409488 12:104457045-104457067 CGCCGCCGCTGCCGCTGCGCTGG - Exonic
1101466926 12:104958370-104958392 CGCCGCCGCCGGGGAAGCCCGGG + Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1101716662 12:107318525-107318547 CGCCGCCGCCGCAGCTCCGCGGG - Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102854053 12:116277794-116277816 CGCCGCCGCCGCCGCCACTCCGG - Intergenic
1103308916 12:119989310-119989332 CGTCGCCGCCGCTGCTGCTGGGG + Intergenic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103377718 12:120469649-120469671 CGCCGCCGCCGCCTCAGCACGGG + Exonic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103527799 12:121579366-121579388 CTCTGCCGCCGCGGCCGCTGGGG - Intronic
1103534761 12:121626826-121626848 CCCCGCTGCGGCGGCGGCTCCGG - Exonic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103764124 12:123269804-123269826 CGCTGCCGCCGCTGCTCCTCCGG - Intronic
1103916958 12:124380665-124380687 AGCCACCGCCCGGGCAGCTCAGG - Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1104376220 12:128267223-128267245 CGCCGCCGCAGCTCCGGCTCTGG - Intergenic
1105031452 12:132887281-132887303 AGTCGCCGCCGCCGCAGCCCTGG - Exonic
1105349500 13:19602439-19602461 CGCCGCCGGGGCGCCAGCGCTGG + Intergenic
1105409596 13:20160890-20160912 GGTCGCCGCCGCGGCAGAGCGGG - Exonic
1105943642 13:25171586-25171608 CCCCGCCGCCGCCGCGGCTCCGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1107359455 13:39603110-39603132 CGAGTCCGCGGCGGCAGCTCTGG + Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107604032 13:42040814-42040836 CCCCGCCGCCGCCGCTGCGCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1108373325 13:49792225-49792247 GGTCGCCGCGCCGGCAGCTCCGG + Intronic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110119770 13:71866572-71866594 CGCCGCCGCCGCCGAAGCGATGG + Exonic
1110630101 13:77697853-77697875 CGCCGCCGCGCCGGCTCCTCGGG - Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112438463 13:99408277-99408299 CGCCACCGGCGGGGCAGCCCAGG - Intergenic
1112507810 13:99985444-99985466 CGCCGCTGCCGCCGCCGCTGGGG - Exonic
1113254839 13:108495690-108495712 CGCCGCCGACGCCGCGGCTGCGG + Intergenic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1113841702 13:113364474-113364496 CGCCGCGGCCTCGGAAGCCCCGG - Intergenic
1114312215 14:21477570-21477592 CCCCGCGGCGTCGGCAGCTCTGG - Intronic
1115203006 14:30874221-30874243 CGCCGCTGCCTCAGCAGCCCTGG + Intergenic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1116657969 14:47674982-47675004 CGCCGCCGCCGCCGCAGCTGCGG - Intergenic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117176735 14:53153217-53153239 CGCCGCTGCCGCCGCAGCTCGGG - Intronic
1117353515 14:54902669-54902691 CGCCGCAGCCGCTGCCGTTCGGG + Exonic
1117377377 14:55129093-55129115 CGCCCCTGCGGCGGCGGCTCGGG + Exonic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1117875750 14:60249124-60249146 CTCCGCCGCCGCTACAGCTGCGG - Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849476 14:69573079-69573101 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118971543 14:70642057-70642079 CGCCGCCGCCGCGCCTTCCCGGG - Exonic
1119743210 14:77027297-77027319 CGCCGCCGCCGCCGCTGCGGTGG - Exonic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1120881341 14:89417152-89417174 CGCCTCCGCCGCGGCGCGTCGGG + Intronic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122486760 14:102087140-102087162 CGCGGCCGCGGCGGCGGCTGGGG - Intronic
1122620937 14:103057409-103057431 CGCCGCCGCCCTCCCAGCTCGGG + Exonic
1122620966 14:103057479-103057501 CGCCGCCGCCGCCGCAGACTAGG + Intergenic
1122917487 14:104865669-104865691 CGCCGCCGCGGAGGCGGCCCTGG + Intronic
1123024883 14:105419872-105419894 CGCCGCCGCCGAGGCCGCCGAGG - Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1123056323 14:105572286-105572308 CCCCCCCGACCCGGCAGCTCAGG - Intergenic
1123057608 14:105579521-105579543 CCCCCCCGACCCGGCAGCTCAGG + Intergenic
1123080754 14:105692414-105692436 CCCCCCCGACCCGGCAGCTCAGG - Intergenic
1123081887 14:105699454-105699476 CCCCCCCGACCCGGCAGCTCAGG + Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125685123 15:41559307-41559329 TGCCGCCGCCACCGCGGCTCGGG + Exonic
1126113292 15:45187768-45187790 CGCCCCCCCCGCGGAAGCCCAGG + Intronic
1126823708 15:52529063-52529085 CGCCGCCGCCGCAGCCACTTCGG + Intergenic
1126823735 15:52529170-52529192 CGCTGCCACCGCGGCTGCTCTGG + Intergenic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1127753436 15:62068009-62068031 CGCCGCCGCCGCCGTAGGTGTGG - Exonic
1127763624 15:62164582-62164604 CTCCGCCGCCGCCGCAGCTGTGG + Exonic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128455697 15:67830111-67830133 CGCCCCGACCGCGGCAGCTCCGG + Intronic
1128841324 15:70853751-70853773 CGCCGCCGGGGAAGCAGCTCCGG - Intronic
1129535580 15:76311356-76311378 CGGCGGCTCCGGGGCAGCTCCGG - Exonic
1129675980 15:77632641-77632663 CGCCGCCGCCTCTGCCGCTGGGG + Intronic
1129844990 15:78764081-78764103 CGCCGCAGCTGCGGGAGCACTGG + Exonic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129893794 15:79089539-79089561 CGCTGCCTCCGCAGCAGCCCTGG + Intronic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130508694 15:84570617-84570639 AGGAGCCGCCGCGGCAGCTCAGG - Intergenic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1130979490 15:88803172-88803194 CGGCGCGGACCCGGCAGCTCCGG - Intergenic
1131215238 15:90530342-90530364 CGCCGAGGCCGCGGCCGCTCCGG - Intronic
1131257379 15:90871552-90871574 GGCGACCGCCGCGGCGGCTCGGG - Intronic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1131735471 15:95326950-95326972 CGCAGCCGCCGCGGCCAATCCGG - Intergenic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132512823 16:352692-352714 CGCCGCCGGCGGGGGCGCTCGGG - Intergenic
1132544639 16:527668-527690 CGCCGACGGGGCGGAAGCTCGGG - Intergenic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1132915349 16:2340818-2340840 CCCGGCCGCCTCGGCCGCTCCGG + Intergenic
1133040880 16:3059244-3059266 CGCCGCCGCCGCCCCTGCGCGGG - Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133933721 16:10252389-10252411 AGCCGCCGCGGCGGCAGCCCGGG - Intergenic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1135135813 16:19884891-19884913 CGCGGCCGCTGCAGCAGCGCGGG - Exonic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136546529 16:30958013-30958035 CGCCGCCGCCGCCACCGCTGCGG + Intronic
1137617703 16:49856950-49856972 AGCCGCCGCCGCCGCTGCCCAGG - Intronic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138471960 16:57245138-57245160 CGCCGCCGACGCCGCAGGTCCGG - Exonic
1138590432 16:57996549-57996571 TGCCGCCGCCGCGGCAGCGGAGG - Exonic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141054620 16:80804026-80804048 CGCCGCGGGCTCGGCAACTCCGG + Intronic
1141132451 16:81445175-81445197 CCCCGCCGCCCCAGCAGCCCAGG + Exonic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141840129 16:86568576-86568598 CGCCTGCGCCGCGGCGGCCCCGG - Exonic
1142240014 16:88940806-88940828 CGCCGCAGCCCCCGCAGGTCAGG + Intronic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1142764452 17:2057555-2057577 CGCGGCGGCAGCGGCAGCCCGGG + Exonic
1143148262 17:4790178-4790200 CGCCTCCGCCTCGGTGGCTCCGG - Exonic
1143587069 17:7855641-7855663 CCCCGCAGCCGCGGCAAATCCGG + Exonic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1144109804 17:12020901-12020923 CGGAGCCGCCGCCGCCGCTCGGG - Exonic
1144907740 17:18650269-18650291 CACCGCCGCTGCGCCAGCCCAGG + Intronic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1145385515 17:22409223-22409245 AGCCGCAGCCGCGGCTGCGCAGG + Intergenic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146255954 17:31391673-31391695 CGCCGCAGCCCCAGCCGCTCCGG - Exonic
1146716246 17:35089200-35089222 CTCCGCCGCGGCGGCGTCTCTGG + Exonic
1146763483 17:35498062-35498084 CGCCGCCCTCGCCGCCGCTCTGG - Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147620774 17:41865262-41865284 CGCCGCCGGCTCGGCAGGACTGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1148084833 17:44987829-44987851 CGCCGCCGCCGCCGTAGATGGGG + Intergenic
1148388549 17:47253872-47253894 GGCCGCGGCCCCGGCCGCTCTGG + Intergenic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148758987 17:49989700-49989722 CACCGCCGCCGGGTCACCTCAGG - Intergenic
1148945758 17:51260493-51260515 GGCCGCCGCCGCCGAAGCCCCGG - Intergenic
1149599710 17:57885525-57885547 CGCCGCTGCCGCTGCTGCTCCGG + Exonic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150212072 17:63446860-63446882 CGCCGCCGCTCCGGGAGCCCTGG + Intergenic
1150484870 17:65536834-65536856 TGCCGCCGCCGCGGCCGCGAGGG - Intronic
1150676046 17:67246097-67246119 CGCGGGCGCCGCTGCAGCTCGGG + Intergenic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152383441 17:79954531-79954553 CGGCGCAGCCACGGCAGTTCAGG - Intronic
1152627965 17:81396906-81396928 CGGCGCCGCAGCGCCAGGTCGGG - Intronic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1152946378 17:83199658-83199680 CTCTGCTGCCGCTGCAGCTCCGG - Intergenic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153770540 18:8412231-8412253 TGCCGCCGCTGTGGCAGCTTCGG + Intergenic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155297362 18:24397675-24397697 GGCCACCGCCTCGGGAGCTCTGG - Exonic
1156099597 18:33578269-33578291 CGCCACCGCCGCGGCCGCTGCGG - Intergenic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1157362558 18:47033182-47033204 TGCCACCGCCGCTGCTGCTCTGG + Exonic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1157662819 18:49460480-49460502 CGCTGTCGCCGCCGCAGCCCAGG + Exonic
1157794222 18:50559979-50560001 CGCCACCGCCGCAGCAGGTGGGG + Intergenic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1158976512 18:62715785-62715807 AGCGGCGGCCGCGGCGGCTCTGG + Exonic
1160025399 18:75211683-75211705 CGCCGCGCCCGGGGCCGCTCAGG - Intronic
1160765220 19:804584-804606 GGCCGCCGCCGAGGCAGCCAAGG - Exonic
1160865515 19:1254298-1254320 GGCCGCCGCCGCTGCTGCGCGGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1160948073 19:1652534-1652556 GCCCGCCGCCGCGTCGGCTCCGG + Intronic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161103231 19:2431700-2431722 CGGGGCCGCCACAGCAGCTCTGG - Intronic
1161721477 19:5904898-5904920 CGCCGCCGGCCCTGCAGATCCGG + Exonic
1162379042 19:10321223-10321245 CCTCGCCGGGGCGGCAGCTCCGG + Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162861099 19:13506289-13506311 CGCCGCCGCCGCTGATGCTGAGG + Intronic
1163138775 19:15332350-15332372 CGGCGCCGCGCAGGCAGCTCGGG - Intronic
1163158137 19:15449914-15449936 CGCCGCCGCCTCCACCGCTCGGG + Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1164834726 19:31349766-31349788 CGCAGCCGCCGCCGCGGCCCGGG + Intergenic
1164835092 19:31350798-31350820 CGCCGCCGCCCGCGCCGCTCGGG - Intergenic
1165129570 19:33623192-33623214 CGCCGCAGCCGCTTCAACTCCGG - Intronic
1165349568 19:35268713-35268735 CGCGGCGGCGGCGGCTGCTCAGG + Intergenic
1165507921 19:36245969-36245991 CGTCTCCCCCGCGCCAGCTCCGG - Intronic
1165854203 19:38870152-38870174 CGCCGCAGCCGCCGCAGCTCCGG + Exonic
1165928642 19:39342542-39342564 CGCCGCCACCGCCGCCGCTCGGG - Exonic
1165956950 19:39507067-39507089 CGGCGCGGCAGCGGCAGCGCAGG - Exonic
1165961646 19:39539861-39539883 TGCCGCCGCCGGGGCTGCCCTGG + Exonic
1166078104 19:40425625-40425647 CGCCCCCGCCGCCGCCGCTTCGG - Intronic
1166105964 19:40598206-40598228 CCCCGCCCCCGCCGCGGCTCGGG - Intronic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166694843 19:44846560-44846582 CGCCGCCGACGCCGCTGCTGTGG + Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167643682 19:50695040-50695062 CGCCGCCGCGGCCCCAGCCCCGG + Intronic
1168100354 19:54138127-54138149 TGCCGCCGCCTCTGCAGCGCGGG + Intronic
1168154536 19:54465382-54465404 GCCCGCCGCCGTGGCGGCTCAGG + Exonic
1168401556 19:56088394-56088416 GGCCGCGGCCGCGGCAGCCATGG - Exonic
925191940 2:1892192-1892214 TGCTGCCCCCGCCGCAGCTCAGG + Exonic
925610504 2:5697200-5697222 CGCTGCGGGCGCCGCAGCTCGGG - Exonic
925984822 2:9206996-9207018 CGCCGCTGCCGCCGCCGCTCCGG - Exonic
926129754 2:10295409-10295431 CGCCACATCAGCGGCAGCTCAGG - Intergenic
926217100 2:10912357-10912379 CGCCGCCGCCGCTGCCGCTGGGG - Exonic
926914409 2:17878699-17878721 CGCCGCCGCGGCGGCAGGCGCGG + Intronic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927713819 2:25340915-25340937 CGCCGCCACCGCGGCCGCCCGGG + Intronic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928278059 2:29920537-29920559 CGGGGCCGCCGCTGCAGCCCCGG - Exonic
929151153 2:38750531-38750553 CGCCGACGCCGCTGCCGCTGCGG - Intronic
929188782 2:39120963-39120985 GGCGGCCGCGGCGGCACCTCAGG - Intronic
929188791 2:39120994-39121016 CGCCGCCGCCGGTGTAGCGCTGG + Exonic
930872757 2:56184638-56184660 CGCAGCCGCCGCCGCGCCTCCGG - Exonic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
931348716 2:61470479-61470501 CGCGGCCGCCGCGGCGCCTCGGG - Intronic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934966853 2:98731105-98731127 CGCCGCTGCCGCCGCCGCTGCGG + Intronic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196643 2:100820239-100820261 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592506 2:104855446-104855468 CGCCGCCGCAGCAGCAGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935692615 2:105744881-105744903 CGCCGCCGCCGCCGCTGCCGCGG + Exonic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
936222041 2:110611136-110611158 CGCCGCCGCCGCCGCTCCTAGGG + Intergenic
937160956 2:119760250-119760272 CGCTGCGGCGGCGGCTGCTCGGG + Exonic
937998815 2:127715826-127715848 CGCCGCCGCCGCCCCATCACTGG - Intronic
938038145 2:128053527-128053549 CGCCGCCGCCGCCCCAATTCTGG + Intergenic
938277343 2:130038037-130038059 GGCCGCCGCCGCCACAGCCCTGG + Intergenic
938438041 2:131299343-131299365 GGCCGCCGCCGCCACAGCCCTGG - Intronic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
940774973 2:157875963-157875985 CACCGCAGCCGCCGCCGCTCTGG - Intergenic
940830355 2:158458092-158458114 CGCGGCGGCCGTGGCCGCTCGGG + Intronic
941020956 2:160407624-160407646 GCCCGGGGCCGCGGCAGCTCTGG + Intronic
942046552 2:172102430-172102452 GGCCGGCGCCGCCGCCGCTCGGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942278193 2:174337443-174337465 CGCCGCCGCTGCCGCCGCCCGGG - Exonic
942463997 2:176189086-176189108 CGCACCTGCCGCGGCAGCTGGGG + Exonic
942678156 2:178450536-178450558 CGCCCCAGCCTCGCCAGCTCTGG - Intronic
943060504 2:183037958-183037980 CGCCTCCGCCGCGGCCTCCCCGG + Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944237065 2:197450583-197450605 CGCCGCCTCAGCGTCCGCTCTGG + Intergenic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945431725 2:209772234-209772256 CGCTGCCGCCGCCGCCGCTGAGG + Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
945988175 2:216371471-216371493 CGCCGCCGCAGCAGCAGCTGCGG - Exonic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947119059 2:226798317-226798339 GGCAGCTGCAGCGGCAGCTCCGG - Exonic
947418571 2:229921958-229921980 CGGCGCGGCGGCGGCGGCTCCGG + Exonic
1169171827 20:3471349-3471371 CGCCGCCGCCGCCGCGGCCTCGG - Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1172100851 20:32483458-32483480 TGCTGCCGCCGCGGCTGCCCGGG + Exonic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1172654369 20:36528006-36528028 CGCCGCCGCCGCTGGCTCTCGGG + Exonic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173243435 20:41317605-41317627 CGCCGCCGCCGCCGCCTCTGCGG - Intronic
1173453920 20:43189176-43189198 AGCCGCCGCCCCGGCAGCCTCGG + Intronic
1173548169 20:43914873-43914895 CGCCGCCGCCGCGCCCGCCATGG + Exonic
1173672872 20:44810292-44810314 CGCCGCCGCCGCCGCGGCCGAGG - Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173741737 20:45406671-45406693 CGCCCCCGCCGCGGCCTCGCTGG + Intronic
1173855993 20:46251193-46251215 CGCCGCCGCCGACGCTGCTGGGG - Exonic
1173939097 20:46894840-46894862 GGCAGCAGCCGCGGCAGCCCAGG + Exonic
1174317516 20:49713903-49713925 CCCCGCCGCTGCGCCCGCTCGGG - Intergenic
1175268711 20:57718770-57718792 AGCCGCCGCCGCTGCAGCCCCGG - Intergenic
1175429054 20:58889963-58889985 CGCAGCCGCCGCCGCAGCTTCGG - Intronic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176061612 20:63175173-63175195 CGGCGCTGCCGGGCCAGCTCGGG - Intergenic
1176155490 20:63618039-63618061 CGCCGTGGCCGCGGCTGCTGGGG - Intronic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178334503 21:31731698-31731720 CGCTGCGGCGGCGGCTGCTCCGG + Exonic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180064472 21:45405556-45405578 CACCCCCGCCCCGGCCGCTCTGG + Intronic
1180110317 21:45644261-45644283 TCCAGCCGCCGCGGCCGCTCCGG - Intronic
1180193984 21:46182687-46182709 CGCCGCCCTCCTGGCAGCTCTGG + Exonic
1180461976 22:15573292-15573314 CGCCACAGCCGCCACAGCTCCGG + Intergenic
1180559227 22:16601981-16602003 GGCCGCCGCCGCCGCTGCTCGGG - Intergenic
1181000843 22:19987156-19987178 CTCCGGCGCCTCGGCCGCTCGGG + Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181934624 22:26429619-26429641 CGCCCCCGCCGAGGATGCTCCGG + Intronic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182237023 22:28883870-28883892 CGCCGCTGCCGCTGCTGCTCGGG + Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1184153153 22:42649817-42649839 CGCCGCCGGCGAGGAGGCTCCGG - Intergenic
1184663711 22:45976941-45976963 CGCCACCGCCGCGTGAGCCCGGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185088118 22:48751707-48751729 CGCCGGAGCCGGGGCAGCTTGGG - Intronic
1185278706 22:49960888-49960910 CGCCGAAGCCGCGGCCGATCCGG - Exonic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185409439 22:50674438-50674460 CGCCGCCGCCGCCGCCCCTGCGG + Intergenic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
949970242 3:9397672-9397694 CGCCGCCGCCGCCGCTGCCGGGG + Intronic
950583488 3:13878166-13878188 CGCCGGCGCCGCGGCCTCCCCGG - Intronic
951078513 3:18425155-18425177 CGCCGCCGCCGCTGCCGCTGTGG + Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951907893 3:27721907-27721929 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952241158 3:31532712-31532734 CGCCGCCGCCGCAGCTGCACTGG + Intronic
953526051 3:43690970-43690992 AGCCGCCGCCGCGCAAGCGCCGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
953989873 3:47475816-47475838 CGCCGCCGCCGCCGCAGCTTGGG - Exonic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956605063 3:71065262-71065284 CGCCGCCCCGCCGGCAGCCCCGG - Intronic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961735858 3:129001823-129001845 GGCCGGCGCCGCGGCAGTCCAGG - Exonic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
962222246 3:133573790-133573812 CGCAGCAGCAGCGGCAGCCCCGG + Exonic
963236724 3:142963614-142963636 CGCCGCCGCTGCCGCAGCGCGGG - Exonic
963882716 3:150546396-150546418 CGCCGCCGTCGCCGCCGCTTTGG + Exonic
964358422 3:155870837-155870859 CGCCGTCACCGCCGCGGCTCCGG + Exonic
965521028 3:169668492-169668514 CGCCGGCGAGGCGACAGCTCAGG + Intergenic
965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG + Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966201080 3:177359908-177359930 CGACGCCGCGGCGGCAGAGCCGG + Intergenic
966362773 3:179148365-179148387 TGCCGCCGCTGCGGCCGCTGAGG + Intronic
967511898 3:190322340-190322362 CGCCGCCGCTGGAGAAGCTCTGG + Exonic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968221451 3:196942951-196942973 CGCGGCCTCCGAGGCCGCTCGGG + Intergenic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968640500 4:1712219-1712241 CGCCGCCGCCGCCTCAGCCTCGG - Exonic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
968701291 4:2059369-2059391 GGCGGCGGCGGCGGCAGCTCAGG - Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968965341 4:3766547-3766569 GGGCGCAGCCGCGGCAGCTCGGG - Exonic
969114557 4:4863010-4863032 CGCCGCGGCCGCTACAGCTGCGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970456183 4:16226427-16226449 CGTCGGCGACGCGGCCGCTCCGG - Exonic
971195703 4:24470763-24470785 CGCCGCCGCGGCAGCAGCAGCGG - Intergenic
971457808 4:26860792-26860814 CGCCGCGGCGGCGGCGGCGCGGG + Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
973754857 4:54064578-54064600 CGCCGCAGCAGCAGCAACTCAGG + Exonic
975118592 4:70705254-70705276 TGCTGCCGCCGCCGCCGCTCGGG - Intronic
975986253 4:80203225-80203247 CGCCGCAGCCGCGGCTGCAGCGG - Exonic
975986256 4:80203234-80203256 CGCGGCCGCCGCCGCAGCCGCGG - Exonic
976431410 4:84966517-84966539 CGCCGCCGCCGCCTCAGCCTCGG + Intergenic
979133978 4:117085460-117085482 CGCCGCCACGGTAGCAGCTCCGG + Exonic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981615214 4:146638315-146638337 CGCCCCCACCCCGTCAGCTCAGG - Intergenic
981782206 4:148442729-148442751 CGCAGCCGCGGCGGGAGCTTGGG + Intronic
982288803 4:153759967-153759989 CTCCGCCGCCGCCGCAGATCCGG - Exonic
982712275 4:158769191-158769213 TGATGCCGCCGCCGCAGCTCCGG - Exonic
982745817 4:159103423-159103445 CGCCGCCGCCTCTGCTGCTCGGG - Intergenic
983904436 4:173169211-173169233 AGCCGCTGCCGCGGCAGCGCGGG - Intronic
983904439 4:173169215-173169237 CGCTGCCGCGGCAGCGGCTCGGG + Intronic
984734781 4:183099107-183099129 CGGCGCTGCCGCGGCAGCGGCGG - Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
987087973 5:14487495-14487517 CGCCGCCGCCGCCCCCGCTGTGG - Exonic
988825323 5:34929736-34929758 CGCCGCCGCCGCCGCCGCTTCGG + Exonic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
989637955 5:43556658-43556680 CACCGCCGCTGCGCCAGCCCAGG - Exonic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990308589 5:54517724-54517746 CGCCGCAGCCGCCGCCGGTCGGG - Intergenic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
992910728 5:81393930-81393952 CGCCGCCGCTCCCGCAGCCCCGG + Intronic
994043579 5:95284546-95284568 CTCGCCCGCCGCGGCAGCCCGGG + Exonic
994107323 5:95961738-95961760 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
995106327 5:108381292-108381314 CGCCGCCGCCGCTGCCGCCTCGG - Exonic
995224708 5:109689791-109689813 CGCCGCCGCCGCCGACGCTGCGG - Exonic
996405627 5:123099764-123099786 CGCAGCCACTCCGGCAGCTCCGG - Exonic
996862814 5:128084232-128084254 CGCCGCCGCCGCCGCAGCAGCGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997013530 5:129905148-129905170 CGCCGCCGCTGCTGCAGCGGAGG - Exonic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997302084 5:132813639-132813661 CGCCGCCGCTGCGGCTGCCGGGG + Exonic
997653011 5:135536030-135536052 CTCCGCCCCCGCGGCAGCCCGGG + Intergenic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
998106204 5:139471018-139471040 CCCCGCAGACGTGGCAGCTCCGG + Intergenic
998132756 5:139659595-139659617 CACCCCCGCAGCGGCAGCTCAGG - Intronic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1002591097 5:180292053-180292075 CGCCGCGGCGGCGGCAGCGGCGG - Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1002927302 6:1611774-1611796 CGCCGCCGCCGCCGTGACTCAGG - Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004864278 6:19837867-19837889 CGCCGCCGCCGCCGCGGCTGCGG - Exonic
1004924052 6:20402373-20402395 CGCCGCCGCTGCCGCCGCCCCGG + Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005040437 6:21595548-21595570 CGGCGCTGCTGCGGCCGCTCAGG - Exonic
1006047287 6:31308486-31308508 CGCCGCGGCTGTGGAAGCTCAGG + Intronic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1006470161 6:34224099-34224121 GGCCGGCGCCGCGCCAGCCCGGG - Intergenic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1007032371 6:38639909-38639931 CGCCGCCGCCCCGGCTGCTGCGG + Exonic
1007665354 6:43510144-43510166 CGCCGCCGCCGCGACCGCGAGGG - Exonic
1007781404 6:44256976-44256998 CGCCCCCTCCGCTGCAGCTCCGG + Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1011128741 6:84033713-84033735 CGCCGCCTCCGCTGCGGGTCGGG + Intergenic
1013033714 6:106360690-106360712 CGCCTCCGCCCCAACAGCTCGGG + Intergenic
1013225675 6:108118205-108118227 CGGCGCGGCCGCAGCATCTCCGG - Intronic
1013514653 6:110875021-110875043 CGCCGCTGCCGCCGCCGCTGCGG - Exonic
1013619325 6:111873024-111873046 CGGCGCGGCCGAGGCGGCTCCGG + Exonic
1015148925 6:130018507-130018529 CGCCGCCGCCGCCGCTGCCGGGG - Exonic
1015625936 6:135181191-135181213 CGCCGCCTCCGCGGTCGCCCTGG - Intergenic
1016714003 6:147203762-147203784 CGCGGCTGCCGCTGCTGCTCCGG + Intergenic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1018156654 6:160991711-160991733 CGCCGCCACCGCCGCCGATCTGG + Intronic
1018867244 6:167755814-167755836 CGCAGCAGCCCCTGCAGCTCTGG - Intergenic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019440641 7:1044608-1044630 CGCCGCCGGGCGGGCAGCTCGGG - Intronic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019828207 7:3301200-3301222 AGCGGCGGCCGCGGCAGCTGAGG + Intergenic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021600223 7:22356986-22357008 CACCGCCGCCGCGGCGGCCAGGG + Intronic
1021827916 7:24573272-24573294 CGCCGCCGCCGCCGCCGCTTGGG - Intronic
1022106253 7:27199829-27199851 CGCGGCCGCCGCCGCAGCCGCGG + Exonic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1022427954 7:30285552-30285574 CGCGGCGGCCGCGGCGGCCCCGG + Exonic
1022427956 7:30285561-30285583 CGCGGCGGCCCCGGCAGCCCCGG + Exonic
1022675485 7:32495460-32495482 CGCCGCCGGCGAGGCAGGGCTGG - Intronic
1022923394 7:35037620-35037642 CGCCGCCGTTGCCGCCGCTCCGG + Intronic
1023405880 7:39833517-39833539 CGCCGCCGCCGCTACCGCTCCGG - Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1025729988 7:64100444-64100466 CGCGGCCGCTGCGGGAGCTGCGG + Intronic
1026815137 7:73505110-73505132 CTCAGCCCCCGCTGCAGCTCTGG + Intronic
1027390279 7:77696904-77696926 CGCCGCCGCCGCCGCTGCCTCGG + Exonic
1027421154 7:78019488-78019510 CGCCGCTGCCGCCGCCGCCCGGG + Exonic
1028198475 7:87934325-87934347 CGCCACGGCCGCCGCAGCACCGG + Intronic
1028262929 7:88686587-88686609 CGCCACCGCCCCAGCAGCTTTGG - Intergenic
1028987741 7:97021358-97021380 CGCCGCCGCCGAGGACACTCGGG - Intronic
1029123115 7:98281514-98281536 CGCCGCCGGCGGGGCGGCTTCGG + Intronic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030727198 7:112939762-112939784 CGCCGCCGCCGCCGCCCCTCAGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1033390641 7:140924592-140924614 CGCCGGCGCCGCGGCCTCTTCGG - Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034618022 7:152435854-152435876 CGCCGCCGCCGCTGCTGCTCGGG + Exonic
1034885554 7:154795688-154795710 CACAGCTGCCACGGCAGCTCTGG - Intronic
1034977736 7:155457978-155458000 CGCCGCCGCCTGGGCCGCCCGGG - Intergenic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035475849 7:159144013-159144035 CGTCGCAGCCGAGGCAGGTCTGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035854821 8:2963427-2963449 CACCGCTGCAGCGGGAGCTCCGG - Intronic
1036788771 8:11704240-11704262 CTTCGTCGCCGCTGCAGCTCCGG + Exonic
1036789502 8:11708672-11708694 CGCCGCCGCTGCCGCGGCCCGGG + Exonic
1037288474 8:17325577-17325599 CGCAGGCCCCGCGTCAGCTCAGG - Intronic
1037901763 8:22692951-22692973 GGCGGCGGCGGCGGCAGCTCGGG - Exonic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1038632941 8:29262941-29262963 CGCCTCCGCCCCGGCGGCCCAGG + Intronic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041201642 8:55455254-55455276 CGCCGCAGCCGCAGCCGCTGCGG - Intronic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041707804 8:60865116-60865138 AGCGGCGGCCGCGGCTGCTCTGG - Exonic
1041919800 8:63168834-63168856 CGCCGCCGCCGCCGCTGCCTGGG - Exonic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042307175 8:67343856-67343878 TCCCGGCGCCGCGGCAGCTCTGG - Intergenic
1042785098 8:72537388-72537410 CGCCGCCGCCGCTGCGCCTCGGG + Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1043847286 8:85177524-85177546 CGCCCCCGCCGCCGCAGCTCGGG + Exonic
1044242432 8:89902641-89902663 CGCCGTTGCCGCGGCTGCCCCGG - Exonic
1044719832 8:95134250-95134272 CGCCGCCGTCCCGCCAGCCCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044832306 8:96262008-96262030 CGCCGCCACCGCGGCAGGACGGG + Exonic
1044934279 8:97278001-97278023 CGCCGCCGCTGCGGCTGCGCAGG + Intergenic
1045111118 8:98940317-98940339 CTCCGCCGCTGCGGCAGCCGAGG + Intronic
1045216906 8:100158067-100158089 CGCGGCCGCCGCACCGGCTCTGG - Intronic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1047499585 8:125431010-125431032 CGCCGACGACGCGGCGGCTGTGG + Exonic
1047756963 8:127926366-127926388 AGCCGCCGTCTCGGCAGCTGGGG - Intergenic
1048214113 8:132480425-132480447 GGCCGCCGCCGCGTCCCCTCCGG + Exonic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049263620 8:141653266-141653288 CCCCGCAGCCCAGGCAGCTCTGG + Intergenic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1049788442 8:144462382-144462404 CGCCGCCGCCTCGGCCGCCTCGG + Intronic
1050087392 9:1980237-1980259 CGCCACCGCCGCCGCTGCTAGGG + Intergenic
1050437926 9:5629189-5629211 GGCGGCGGCGGCGGCAGCTCGGG - Exonic
1051079689 9:13279656-13279678 CACCGCCTCCGCGGCAGCCCCGG - Intergenic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052806735 9:33020033-33020055 CGCGGACACCCCGGCAGCTCCGG - Intronic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053070207 9:35096573-35096595 CGCCGCCGCCGCCGCACTTCCGG - Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1054798629 9:69325390-69325412 CGCCGCTGCCGCCGCCGCTCAGG + Intronic
1054798675 9:69325549-69325571 CGCCGCTGCCGCCGCGGCCCCGG + Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1055514229 9:77020412-77020434 CGCGGCCGCGGCGGCAGCGGCGG - Exonic
1055514231 9:77020415-77020437 CGCCGCGGCCGCGGCGGCAGCGG - Exonic
1055796068 9:79976111-79976133 CGCCTCCCCCGCCGCAGCTGTGG - Intergenic
1055936833 9:81611792-81611814 CGCAGCCGCCGCGGCCGCCGTGG - Exonic
1056143571 9:83707676-83707698 CGCCGCCGCCGCCACAGCCATGG - Exonic
1056746761 9:89310438-89310460 CGCCGCCACCGCGCCGGCTCCGG + Intergenic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1057313377 9:93954988-93955010 CGCCGCGGCAGCGGCGGCTGCGG + Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1057921970 9:99105101-99105123 CGAGGCCGCCGCGGCGGCTAGGG + Exonic
1057933989 9:99221639-99221661 CGCCGCGGCCGCCCCAGCCCAGG + Exonic
1059414796 9:114155976-114155998 CGCCGCCGCCGCTGTGCCTCGGG - Exonic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1059769782 9:117414623-117414645 CGCCGCCGCCGCCGCGTCCCCGG - Exonic
1059769784 9:117414630-117414652 CGCGGCGGCGGCGGCGGCTCCGG + Exonic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1060389817 9:123268293-123268315 CACCGCCGCCGCCGCTGCTAAGG + Intronic
1060821754 9:126665304-126665326 CGCCCCCGCCGCCCCAGCCCTGG - Intronic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061196662 9:129110569-129110591 CGCCGCCGCCGCCGCGGCTGGGG + Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203773673 EBV:61493-61515 CGCCCCCGCCGCGACGGCTGTGG - Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1186452926 X:9688135-9688157 AGCCGCCGCCGCCGCCGCACTGG - Exonic
1187547313 X:20266716-20266738 CGCCGCCGCCGCCGCTGCCGTGG - Exonic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1189332316 X:40151718-40151740 CGCCGCCGCCGCCACCGCTGCGG - Intronic
1190266943 X:48832243-48832265 CGCCCCCGCCGCCTCACCTCGGG + Exonic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196031074 X:111096311-111096333 CGCGGCCGCAGCCGCAGCCCCGG - Intronic
1198388138 X:136147716-136147738 CCCCGCCGCCGCCGCCGCTCGGG + Intronic
1198727422 X:139692099-139692121 CGGCGCCGAAGCGGCAGCTTGGG + Intronic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1198807146 X:140503980-140504002 CACCGCCGCGGCCGCAGCTGCGG - Exonic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1199699482 X:150365011-150365033 CCCGGCCGCCACCGCAGCTCTGG + Intronic
1200068788 X:153517836-153517858 CGCCGCCGCGGCCTCGGCTCCGG - Intronic
1200229538 X:154437163-154437185 CGCCGCCGCCGCCACCGCACTGG - Exonic
1200231085 X:154444217-154444239 CGCCGCCGCCGCCGCTGCCATGG + Exonic
1200238098 X:154478834-154478856 CCACGCCCCCGCGGCAGCTGTGG + Exonic