ID: 1139637468

View in Genome Browser
Species Human (GRCh38)
Location 16:68266421-68266443
Sequence TAATTAGGACTGCCCCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139637463_1139637468 4 Left 1139637463 16:68266394-68266416 CCCTGTGGGTGTCATGGAACCTG 0: 1
1: 0
2: 0
3: 21
4: 146
Right 1139637468 16:68266421-68266443 TAATTAGGACTGCCCCTGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 81
1139637461_1139637468 8 Left 1139637461 16:68266390-68266412 CCCACCCTGTGGGTGTCATGGAA 0: 1
1: 0
2: 2
3: 13
4: 142
Right 1139637468 16:68266421-68266443 TAATTAGGACTGCCCCTGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 81
1139637462_1139637468 7 Left 1139637462 16:68266391-68266413 CCACCCTGTGGGTGTCATGGAAC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1139637468 16:68266421-68266443 TAATTAGGACTGCCCCTGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 81
1139637464_1139637468 3 Left 1139637464 16:68266395-68266417 CCTGTGGGTGTCATGGAACCTGC 0: 1
1: 0
2: 2
3: 13
4: 166
Right 1139637468 16:68266421-68266443 TAATTAGGACTGCCCCTGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139637468 Original CRISPR TAATTAGGACTGCCCCTGCC GGG Intronic
901652055 1:10748655-10748677 CAACCAGGCCTGCCCCTGCCTGG - Intronic
901683266 1:10928707-10928729 TTGTCAGGAATGCCCCTGCCAGG + Intergenic
906157947 1:43625171-43625193 TAGTCAGGACTGCCCCAGGCAGG + Intergenic
906461299 1:46036640-46036662 TAACTAGGATTGCCTCAGCCAGG + Intergenic
908382188 1:63607226-63607248 TAAATGGAACTTCCCCTGCCTGG - Intronic
914947256 1:152078724-152078746 AAATGAGGAGTGCCTCTGCCTGG - Intergenic
915221761 1:154380191-154380213 TAGTGAGGAGTGCCTCTGCCTGG - Intergenic
915348096 1:155208225-155208247 TGTCTAGCACTGCCCCTGCCAGG - Intronic
916498395 1:165365624-165365646 TAATTAGCACCTCCTCTGCCTGG + Intergenic
918393859 1:184094329-184094351 TAATTGAGGCTGGCCCTGCCAGG - Intergenic
1066026114 10:31362086-31362108 AAGTAAGGAGTGCCCCTGCCCGG - Intronic
1081948551 11:47021515-47021537 AATTAAGGACTCCCCCTGCCAGG - Intronic
1084864073 11:72041564-72041586 TAATTAGATCAGCCCCTGCCTGG + Intronic
1085238724 11:75034397-75034419 TGATGAGGACTTGCCCTGCCAGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091787139 12:3250012-3250034 AAATTAGGACTACCCATGCTGGG + Intronic
1095735255 12:45548946-45548968 TAATTAGCACTGCCTGGGCCTGG - Intergenic
1097626919 12:62011154-62011176 AAATGAGGAGTGCCTCTGCCCGG + Intronic
1100338307 12:93654303-93654325 GAACTAGCACTGCCCCTTCCTGG - Intergenic
1101778724 12:107816796-107816818 TAATTAGGCCAGCCACTTCCAGG - Intergenic
1104986979 12:132602863-132602885 TGCTGAGGACTGCCCGTGCCAGG + Intergenic
1109024178 13:57139589-57139611 TAATCAACACTGCCCCAGCCCGG + Intergenic
1109025073 13:57145689-57145711 TAATCAACACTGCCCCAGCCCGG + Intronic
1109026060 13:57152259-57152281 TAATCAACACTGCCCCAGCCCGG + Intronic
1109027050 13:57158832-57158854 TAATCAACACTGCCCCAGCCCGG + Intergenic
1109028042 13:57165403-57165425 TAATCAACACTGCCCCAGCCCGG + Intergenic
1109029028 13:57171968-57171990 TAATCAACACTGCCCCAGCCCGG + Intergenic
1118650822 14:67892545-67892567 TTTTCAGGACTGCCCTTGCCTGG + Intronic
1130897525 15:88182724-88182746 TAATGAGGACTGCCATTTCCTGG - Intronic
1131179576 15:90230764-90230786 CAAGGAGGGCTGCCCCTGCCCGG + Intronic
1132741045 16:1413719-1413741 TAATTACGACTCCCTCTGCAGGG + Intronic
1139637468 16:68266421-68266443 TAATTAGGACTGCCCCTGCCGGG + Intronic
1140873598 16:79129562-79129584 TAATTAGGATTACCTCTACCTGG + Intronic
1140973345 16:80035276-80035298 TACTAATGACTGCCCCTGCTGGG + Intergenic
1160425616 18:78777088-78777110 TAATTGGAAATGCCCCTGCCAGG - Intergenic
1161718543 19:5891102-5891124 TAATAACAACTGCACCTGCCTGG + Intronic
1164005429 19:21144091-21144113 TAATCAGCACTGCCACTCCCTGG + Intronic
1164023167 19:21327208-21327230 TAATTAGCACTACCACTCCCTGG - Intronic
1164070646 19:21765249-21765271 TAATCAGCACTGCCACTACCTGG - Intronic
1164230030 19:23279087-23279109 TAATCAGTACTGCCACTCCCTGG + Intergenic
927731042 2:25472054-25472076 TAATTAGTACTTCCTCTGCTAGG - Intronic
942136103 2:172927017-172927039 TAATTAGTAATGACCCAGCCTGG + Intronic
944414018 2:199466090-199466112 TGCTGAGGGCTGCCCCTGCCAGG + Intronic
948676187 2:239598171-239598193 TAAGCAGGACGGCTCCTGCCTGG - Intergenic
1170950468 20:20931445-20931467 TATTTAGGATCGTCCCTGCCTGG + Intergenic
1174158648 20:48534509-48534531 TAATTAAGACTGCCCGAGCCAGG + Intergenic
1174489846 20:50885121-50885143 TAATTAGGACTCTCACTGGCAGG - Intergenic
1175800849 20:61800306-61800328 TACGCAGAACTGCCCCTGCCCGG - Intronic
1177657990 21:24044189-24044211 TAATGAAGACTCCCCCTGCAGGG - Intergenic
1178133155 21:29596248-29596270 TAACAAGGACTGATCCTGCCTGG + Intronic
1178688175 21:34728115-34728137 TGATTAGGTCAGCCCCTCCCAGG + Intergenic
1179632884 21:42689369-42689391 CAATTAGCACTGCACCTTCCGGG - Intronic
1180948678 22:19710567-19710589 TGATTGGGACAGCCCCTGGCTGG + Intergenic
1181675000 22:24445586-24445608 TTGTTAGGACAGCCCCTGTCAGG + Intergenic
1184415292 22:44348732-44348754 AAATCAGGTCTGACCCTGCCAGG + Intergenic
951197461 3:19840238-19840260 AAATGAGGAGTGCCTCTGCCTGG + Intergenic
953145103 3:40267694-40267716 GAATTAGCACTGCCCCTTACAGG - Intergenic
953721872 3:45363352-45363374 TATGTAGGGCTGCCCCTTCCAGG - Intergenic
960317399 3:116194689-116194711 TATTTAGGAATCCCCCGGCCGGG - Intronic
962255165 3:133865522-133865544 TCATTAGGACGGGCCCTGCACGG + Intronic
962403333 3:135079948-135079970 AACTTAGGAGTGCCCCTGGCTGG + Intronic
964794690 3:160483969-160483991 AAATTAGAACTCCCCCTTCCAGG + Intronic
966255707 3:177914487-177914509 AAATGAGGAGTGCCTCTGCCTGG - Intergenic
987874152 5:23657624-23657646 TAAATAAGACTGCCTCGGCCGGG + Intergenic
988298493 5:29393670-29393692 TTATTAAGGCTGCCCATGCCAGG - Intergenic
992134759 5:73733282-73733304 TAATAATGAATGCCTCTGCCTGG - Intronic
995713343 5:115056716-115056738 TAATTAGCACTTGCCTTGCCTGG + Intergenic
996510927 5:124315147-124315169 TAACTAGGACTACCCGTGTCGGG - Intergenic
996603193 5:125290677-125290699 TGTTAAGGACTCCCCCTGCCTGG - Intergenic
1001321744 5:170688182-170688204 TAACTAGGACTGCCCTTCCTAGG - Intronic
1002595823 5:180322080-180322102 TAATTAAGACTGTCCAGGCCGGG - Intronic
1006561328 6:34915294-34915316 TAATTAGTACTGCAGCTGTCGGG + Intronic
1009398311 6:63228214-63228236 AAATGAGGAGTGCCTCTGCCTGG - Intergenic
1010323443 6:74539438-74539460 CCATTAGGGCTGCCCCTACCTGG + Intergenic
1013705907 6:112833612-112833634 TTGTCAGGACTGGCCCTGCCTGG + Intergenic
1021788522 7:24176718-24176740 TTATAAGCTCTGCCCCTGCCTGG + Intergenic
1025802148 7:64796406-64796428 TAATCAGCACTGCCACTCCCTGG + Intronic
1027504278 7:78996085-78996107 TACTTAGGAATGGCCCTGGCTGG + Intronic
1032418296 7:131755998-131756020 AAATGAGGAGTGCCTCTGCCCGG - Intergenic
1039961937 8:42254979-42255001 AAATGAGGAGTGCCTCTGCCCGG + Intergenic
1043388811 8:79771385-79771407 TAAATGGGACTGCCCAGGCCTGG + Intergenic
1049385786 8:142342310-142342332 TACTTAGGTCTGCCCCGTCCAGG + Intronic
1059348064 9:113645755-113645777 TCATGAGAACTGACCCTGCCAGG + Intergenic
1062039490 9:134397571-134397593 TACTGGGCACTGCCCCTGCCGGG + Intronic
1192245894 X:69371320-69371342 TTACTAGGAAAGCCCCTGCCAGG - Intergenic