ID: 1139640561

View in Genome Browser
Species Human (GRCh38)
Location 16:68288576-68288598
Sequence GTGGCTGTGTACAGTCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139640555_1139640561 7 Left 1139640555 16:68288546-68288568 CCCAGTTCTCTAGGTCATCAGTC 0: 1
1: 0
2: 4
3: 17
4: 142
Right 1139640561 16:68288576-68288598 GTGGCTGTGTACAGTCACCCGGG 0: 1
1: 0
2: 2
3: 11
4: 154
1139640556_1139640561 6 Left 1139640556 16:68288547-68288569 CCAGTTCTCTAGGTCATCAGTCC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1139640561 16:68288576-68288598 GTGGCTGTGTACAGTCACCCGGG 0: 1
1: 0
2: 2
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139640561 Original CRISPR GTGGCTGTGTACAGTCACCC GGG Intronic
900775870 1:4585191-4585213 GTGGATGTGTGGAGTCAGCCAGG + Intergenic
904239791 1:29136510-29136532 GTGGCTGTGGAGTGGCACCCTGG + Intergenic
904824014 1:33262979-33263001 GTGGCTGTGTGCTGTTTCCCAGG - Intronic
908615137 1:65911898-65911920 GTGGCATTGTACCATCACCCAGG - Intronic
910616900 1:89208367-89208389 GTTGCTTTGTACAGTCATTCAGG - Intergenic
914684028 1:149962200-149962222 GTGGCTGTGTACATTAAAACAGG - Intronic
915888783 1:159751383-159751405 GAGGCTGTGCACAGTCAGTCTGG + Intergenic
919823749 1:201489411-201489433 GTGGCTGTTGGCAGTCAGCCTGG - Intronic
920848257 1:209611409-209611431 GTGGCTATTTACACTCATCCAGG - Intronic
921529977 1:216269812-216269834 GTGGATATGCACAGTCAACCGGG + Intronic
921710889 1:218371907-218371929 GTGGCTCTAAACAATCACCCTGG - Intronic
924632036 1:245750369-245750391 GAGGCCGTGTACAGGCACTCTGG + Intronic
1071463693 10:85921170-85921192 GAGGCTGGGTGCAGTCAGCCAGG + Intronic
1071565362 10:86668780-86668802 GTGGCAGGGTGCACTCACCCGGG - Exonic
1072764364 10:98083716-98083738 GTGGCTGGGTACAGAAAGCCAGG - Intergenic
1073104446 10:101024159-101024181 GTTGCTGGGCACAGTCACACAGG + Intronic
1073456631 10:103640757-103640779 GGGGCTCTGCACACTCACCCAGG + Intronic
1074535815 10:114328148-114328170 GTGGGTGTGGACAGTGACTCAGG - Intronic
1075669421 10:124253851-124253873 GGGTGTGTGCACAGTCACCCTGG - Intergenic
1080903290 11:36515713-36515735 ATTACTGTGTACAGTCTCCCCGG - Intronic
1083715075 11:64570556-64570578 GGCCCTGTGAACAGTCACCCAGG - Intronic
1093223393 12:16450248-16450270 GTGTCTGTGTCCAGTCACTTGGG + Intronic
1095331461 12:40970216-40970238 GGTGCTGTGAACAGTCACCAAGG - Intronic
1095530410 12:43180611-43180633 ATGGCTGTGTCCAGTCACTGTGG - Intergenic
1100318665 12:93468824-93468846 GTGGCTGTGTACACCCTCCAAGG - Intronic
1102560561 12:113759160-113759182 GAGGCTGTGTGCTGTCACCATGG + Intergenic
1103392492 12:120584672-120584694 GCGGCTGTTTGCAATCACCCGGG + Intergenic
1106315688 13:28591333-28591355 GGGGTTTTGTACTGTCACCCAGG + Intergenic
1107309651 13:39062832-39062854 GTGGCAGATTAGAGTCACCCTGG + Intergenic
1107378303 13:39828617-39828639 GTGGGAATGTACAGTCACCCTGG + Intergenic
1111432434 13:88161383-88161405 GTGGCTGAGTACTGCCACCTGGG + Intergenic
1114498515 14:23151148-23151170 CTGGCTGTGGACAGTCTCCGTGG - Intronic
1119667985 14:76498600-76498622 CTGGCTGTGTGCAGACTCCCGGG + Intronic
1123174275 14:106401878-106401900 GTGGCTGAATACAGTGACACTGG - Intergenic
1123182486 14:106482813-106482835 GTGGCTGAATACAGTGACACTGG - Intergenic
1202944416 14_KI270726v1_random:13916-13938 GTGGCTGAATACAGTGACACTGG + Intergenic
1125579948 15:40778159-40778181 GGGGTTTTGTACTGTCACCCAGG - Intronic
1126828516 15:52575223-52575245 ATGGCTGTGTACAGTGGCTCAGG - Intergenic
1129368661 15:75073334-75073356 GTGCGTGTGTACTGTCACCCTGG - Intronic
1129739592 15:77983846-77983868 GTGGCTGTGCAAAGTCCCCAGGG + Intergenic
1129741619 15:77992324-77992346 GAGGCTGTGTACAGCCCCCGTGG + Intronic
1129834601 15:78694186-78694208 GTAGCTGGGGTCAGTCACCCAGG + Intronic
1131149802 15:90040160-90040182 GTGGCTGGGTGAGGTCACCCAGG + Intronic
1131676310 15:94674021-94674043 GTGGCTTTCTCCAGTAACCCAGG - Intergenic
1132652810 16:1029152-1029174 GTGGCTGTTTCCGGTCACCAGGG + Intergenic
1136578102 16:31136107-31136129 GTGTGTGTGTGCAGTCTCCCTGG + Intergenic
1138087483 16:54146007-54146029 GTGGATGGGAACAGTCACCTGGG - Intergenic
1138688514 16:58747245-58747267 CTGGCTGGGCACAGTCACCCAGG - Intergenic
1139640561 16:68288576-68288598 GTGGCTGTGTACAGTCACCCGGG + Intronic
1140180936 16:72717963-72717985 ATGGTTTTGTTCAGTCACCCAGG - Intergenic
1141506673 16:84482650-84482672 ATGGCTGTGTACACACACACGGG - Exonic
1141807000 16:86348390-86348412 GTGGCTGTGGGCAGCCTCCCTGG - Intergenic
1142323288 16:89398890-89398912 CTGGCTGTGCACAGCCACCCAGG + Intronic
1143777734 17:9210303-9210325 GGAGCTGTCTACAGCCACCCTGG + Intronic
1145775510 17:27525222-27525244 AGGGCTGTGTACAGTCAAGCAGG + Intronic
1146950367 17:36901185-36901207 GTGTCTGTGTACATGCACACGGG + Intergenic
1148019542 17:44544162-44544184 GTGCCTGTGTCCAGGCTCCCAGG + Intergenic
1148197161 17:45722303-45722325 GTGGCTTTAGACAGTCTCCCTGG + Intergenic
1150479503 17:65498584-65498606 GAGGCTGTATACACTCAGCCAGG + Intergenic
1151830478 17:76546363-76546385 GTGGCTGTCCACTGTCACCCTGG + Intronic
1152079896 17:78180232-78180254 GTGTCTGTATACAGCCAGCCAGG + Intronic
1152460368 17:80439142-80439164 GTGGCTGTGCACAGGCAACCAGG + Intergenic
1153107592 18:1545622-1545644 GTGGCTGTGCACTGTCAGCTGGG - Intergenic
1154484483 18:14862761-14862783 TTTGCAGTGTACAGTCACCATGG - Intergenic
1160327188 18:77961620-77961642 GTGGGTGCATAAAGTCACCCTGG + Intergenic
1161041674 19:2113715-2113737 GTGGGTGTGGACAGGCTCCCAGG + Intronic
1161044131 19:2125863-2125885 CTGGCTGAGTACAGTAACTCAGG + Intronic
1163962214 19:20707531-20707553 TTGGCTGTTTAAAGTCACCTAGG - Intronic
1164392821 19:27840656-27840678 CTGGCTGTGTGCAGGCAGCCAGG - Intergenic
1164703408 19:30302424-30302446 GTGGCTTTGCACAGTGACCTGGG + Intronic
1165967594 19:39596208-39596230 GTAGCTGTTTACAGCCACACAGG + Intergenic
1165979699 19:39709703-39709725 GTAGCTGTTTACAGCCACACAGG + Intergenic
1166455672 19:42938012-42938034 GTGGCAGTGAAGAGTTACCCAGG + Intronic
1167157674 19:47749381-47749403 GTGGTTGTGAGCAGTCAACCAGG + Intronic
925048957 2:796349-796371 GTGGCTGTGCAAAGTCTTCCAGG - Intergenic
925085767 2:1106277-1106299 GTGGATGTGTGCTGTCACTCGGG + Intronic
925281857 2:2690512-2690534 GTGGCTGTGGACAGGGACCTGGG - Intergenic
927148544 2:20182617-20182639 TTGGCTGAGTCCAGTCACTCAGG + Intergenic
927905163 2:26849842-26849864 GTGGCTGTCTGCAGGCCCCCAGG - Intronic
927909363 2:26885621-26885643 GTGGCTGTGGACAAGGACCCAGG + Intronic
931838301 2:66123529-66123551 GTGACTGAGTCCAGTTACCCAGG - Intergenic
932493601 2:72136005-72136027 CTGGCTGCGTACAGTGGCCCTGG - Intronic
933498389 2:83080777-83080799 GTGGCTGTGTGTGGTTACCCTGG + Intergenic
936513565 2:113167689-113167711 TTGGATGTTTACAGTCCCCCTGG - Intronic
937320036 2:120955559-120955581 GTGCCTGTGGACAGCCATCCTGG - Intronic
937549674 2:123072218-123072240 GTGGATGAGTACAGTGATCCTGG + Intergenic
943780161 2:191814650-191814672 TTGGCTGTGTCCAGTCACAATGG - Intergenic
946405467 2:219489792-219489814 GAGGCTCTGCACAGTCACCTTGG - Exonic
946853288 2:223928764-223928786 ATCGCTGAGTACACTCACCCTGG + Intronic
947644237 2:231726508-231726530 GTGGCTGGATACATCCACCCAGG - Intergenic
949073225 2:242039235-242039257 GTGGGTGTGTCCCTTCACCCCGG + Intergenic
1172060867 20:32186547-32186569 GTGGCTTTGTCCAGTCACAAGGG - Intergenic
1173842836 20:46169736-46169758 GTGGCTGTGGACAAGCACCAGGG - Intergenic
1176723220 21:10410093-10410115 TTTGCAGTGTACAGTCACCATGG - Intergenic
1176796845 21:13376704-13376726 TTTGCAGTGTACAGTCACCATGG + Intergenic
1178074565 21:29002968-29002990 CTGGCTGCCTACAGACACCCGGG - Intergenic
1179567603 21:42258855-42258877 GTGGCTGTCTAGAAGCACCCAGG + Intronic
1179904293 21:44414209-44414231 GTGGCTGTGCACACTCCACCAGG - Intronic
1180304377 22:11062830-11062852 TTTGCAGTGTACAGTCACCATGG - Intergenic
1181413131 22:22738938-22738960 GTGTCTGTGGACAGTCAGCAAGG + Intronic
1182096033 22:27626633-27626655 GTGCCAATGAACAGTCACCCTGG + Intergenic
1182333368 22:29567094-29567116 CTCGCTCTGTACTGTCACCCAGG - Intronic
1184476423 22:44724550-44724572 GTGCCTGTGTACTTTCAGCCTGG + Intronic
1184723004 22:46326432-46326454 GGTGCTGTGGACAGTGACCCTGG - Exonic
1184902682 22:47457421-47457443 GTGGCGGTGAACGCTCACCCTGG - Intergenic
1184990459 22:48165317-48165339 ATGGGTGTGTACACTCAGCCAGG + Intergenic
1185024727 22:48402396-48402418 GTGGCTGAGCACAGACACCAAGG - Intergenic
950099411 3:10347828-10347850 CTGACTGTGTGCAGTCACCAGGG + Intronic
950556367 3:13698608-13698630 GTGGCTGTGCACAGCCAGCCTGG - Intergenic
954300367 3:49697880-49697902 GTTGCTGTGTCCAATCACCTGGG - Exonic
955106851 3:55906769-55906791 GAGGCTGTGAACATTCATCCTGG + Intronic
958096375 3:88950810-88950832 GTGGCTGTGTATAGGCATTCTGG - Intergenic
958428047 3:94002346-94002368 GTGGCTGGGTACAGTGGCTCAGG - Intronic
960119095 3:113928050-113928072 GTGCCTGTGTACAATCCTCCAGG + Intronic
963591264 3:147262508-147262530 GGTTTTGTGTACAGTCACCCAGG + Intergenic
963745087 3:149117695-149117717 TTGCCTTTGTACAGTCATCCTGG + Intergenic
964527658 3:157632153-157632175 GTGGCAGTGTGCAGTCACACAGG + Intronic
966716344 3:183016610-183016632 GAGCATGTGTACAGTCACCTGGG - Intronic
968131030 3:196192902-196192924 GAGGCTGTGAGCAGCCACCCTGG + Intergenic
969371358 4:6733410-6733432 GTGGCAGTGTGCGGTCAGCCCGG + Intergenic
969375575 4:6761289-6761311 GTGGCTGTGAACACTGACCCTGG - Intergenic
970519265 4:16865700-16865722 GTGGCTGTCTACAGTCACTCTGG + Intronic
971375378 4:26051750-26051772 TTGGCCTTGTACAGTCAGCCTGG - Intergenic
972397550 4:38671027-38671049 GTGGGTGTGCACAGCCACACTGG - Intronic
977241525 4:94576008-94576030 TTTGCTGTTTACTGTCACCCTGG - Exonic
978191377 4:105916501-105916523 TTGGCTGGGTACAGTGGCCCAGG - Intronic
983366036 4:166790670-166790692 GTGAATGTGTACAATTACCCAGG + Intronic
985484771 5:141878-141900 GTGGCTGTCTCCAGGCACCGCGG - Intronic
987722588 5:21657383-21657405 GTGGAGCTGGACAGTCACCCAGG + Intergenic
992778497 5:80108012-80108034 ATGGCTGGGCACAGTCTCCCAGG - Intergenic
1002634493 5:180600388-180600410 GTGGCTTTGAGCAGCCACCCGGG + Intergenic
1002723196 5:181278217-181278239 TTTGCAGTGTACAGTCACCATGG - Intergenic
1003507531 6:6751983-6752005 GGGGCTCTGTCCAGCCACCCTGG - Intergenic
1007484706 6:42173009-42173031 GCTGCTGTGTACAGTTATCCAGG - Intronic
1007513742 6:42394967-42394989 GTGGCTGGGTACAGTTTGCCTGG - Intronic
1008494034 6:52114829-52114851 GGGGCTGTGTAGAATCACCTAGG + Intergenic
1011140305 6:84147425-84147447 GTTGCCAAGTACAGTCACCCTGG - Intronic
1019331822 7:464080-464102 GTGGCTGTGTCCAGGCAGGCGGG + Intergenic
1019685660 7:2380557-2380579 TCGGCTGTGTACAGGCACCGTGG - Exonic
1019751744 7:2735021-2735043 GTGGCTGTGCCAAGTCCCCCCGG + Intronic
1019889488 7:3934928-3934950 GGGGCTTTGCACAGTCTCCCTGG - Intronic
1029196477 7:98809160-98809182 GTGACTGTGACCAGTCACCTGGG - Intergenic
1031702760 7:124945324-124945346 GTGACTGTGAGCAGTCACACTGG - Intergenic
1032197827 7:129799523-129799545 GGGGCTGTGCACTGTCAGCCAGG + Intergenic
1033319156 7:140324255-140324277 GAGGCTGTTATCAGTCACCCAGG + Intronic
1035789994 8:2295961-2295983 GTGGCTGTCGCCGGTCACCCCGG + Intergenic
1035802811 8:2425744-2425766 GTGGCTGTCGCCGGTCACCCCGG - Intergenic
1040434552 8:47377611-47377633 GTAGCTGTGGTCAGTCACACAGG - Intronic
1040695222 8:49988044-49988066 GAGCCTGTGTACAGTCACCCTGG - Intronic
1040827991 8:51644847-51644869 GTGGCCGTCTACAATCAGCCTGG - Intronic
1041390025 8:57339635-57339657 GGGGCTGGGTACAGCCACCTCGG - Intergenic
1047315861 8:123732333-123732355 GAGGGTGTGAACAGTGACCCTGG - Intronic
1047801490 8:128314945-128314967 GTGGCTGTGTAAAGACCCCCTGG + Intergenic
1047961567 8:130015692-130015714 GGGGCTGTGTACACACACACTGG - Intronic
1049405033 8:142448612-142448634 GTGCCTGGGGACAGCCACCCAGG + Intergenic
1049747235 8:144268194-144268216 GGGGCTGTCTGCAGTCACCCCGG - Exonic
1049785691 8:144449677-144449699 GTGGCTGAGTCCTGTCTCCCTGG + Exonic
1053174745 9:35914633-35914655 GCGGCTGTGCAAGGTCACCCTGG + Intergenic
1053303612 9:36968984-36969006 GTGGCTCTGCCCAGTCATCCTGG + Intronic
1056447967 9:86684898-86684920 GTGGCAGAGTAGAGTCCCCCTGG + Intergenic
1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG + Intronic
1057714751 9:97483188-97483210 GTGCCTGTGGCCTGTCACCCAGG + Exonic
1057928194 9:99171074-99171096 GAGGCTGTGAACAGTTGCCCTGG - Intergenic
1061926082 9:133806708-133806730 GTGGCTGTGTCCTGCCTCCCTGG - Intronic
1062688609 9:137829016-137829038 CGGGCTCTGTACAGACACCCGGG - Intronic
1194345421 X:92757308-92757330 GAGGCTCTGCACAATCACCCAGG - Intergenic
1199448375 X:147953056-147953078 GTGGCTGTGTGCAGTGGCTCAGG - Intergenic
1200653765 Y:5873958-5873980 GAGGCTCTGCACAATCACCCAGG - Intergenic