ID: 1139646388

View in Genome Browser
Species Human (GRCh38)
Location 16:68334154-68334176
Sequence CACCCAGCTGAGGCATCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139646383_1139646388 29 Left 1139646383 16:68334102-68334124 CCACTGCAATCATTAAATCATTA 0: 1
1: 0
2: 0
3: 22
4: 238
Right 1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG 0: 1
1: 1
2: 1
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139646388 Original CRISPR CACCCAGCTGAGGCATCCTG AGG Intronic
900291695 1:1926423-1926445 CACCCAGCTCAGGCGGCCTGCGG - Intronic
900356530 1:2267716-2267738 AACGCAGCTGGGACATCCTGAGG + Intronic
900357631 1:2272407-2272429 CCCCCAGCGGAGGGCTCCTGTGG - Intronic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
901052570 1:6432627-6432649 CACACTGCTGGGGCATCCTAGGG + Intronic
902276852 1:15346077-15346099 CACACATCTGAGTCATCATGTGG - Intronic
903395307 1:22997571-22997593 CACCTGGCTGAGGCAGGCTGAGG + Intergenic
904323214 1:29709998-29710020 CACACAGTTGGGGCATGCTGGGG - Intergenic
906201098 1:43960929-43960951 CACACAGCTGTGGCACCATGGGG - Exonic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
906566825 1:46806854-46806876 GTCCCAGCTCAGGCATTCTGAGG + Intronic
907323324 1:53619272-53619294 CACCAGGCTGAGGGCTCCTGAGG - Intronic
907949935 1:59173211-59173233 CACTCAGATGAAGCATCCCGGGG + Intergenic
908254809 1:62294461-62294483 CACCCAGCTGATGCCTGCAGAGG - Intronic
908527392 1:65001330-65001352 CCGCCAGCAGAGGCCTCCTGCGG + Intergenic
908831660 1:68185088-68185110 CACCCAGCTGATGTCTGCTGTGG - Intronic
910134447 1:83950811-83950833 CATGCAGCTTTGGCATCCTGAGG + Intronic
910512935 1:88026019-88026041 CACACAGCAGAGGGACCCTGGGG + Intergenic
913972402 1:143424519-143424541 CACCCAGGTCAGGGATCCAGGGG - Intergenic
914066784 1:144250132-144250154 CACCCAGGTCAGGGATCCAGGGG - Intergenic
914112369 1:144716222-144716244 CACCCAGGTCAGGGATCCAGGGG + Intergenic
915171728 1:153982792-153982814 ACCCCAGCCGAGGCATTCTGGGG + Exonic
915556691 1:156664778-156664800 CACACAGCTAGGACATCCTGTGG - Intergenic
916174123 1:162023724-162023746 CAGCCACCTGAGCCCTCCTGCGG - Exonic
916796357 1:168171237-168171259 CACTAAACTGAGGGATCCTGAGG + Intergenic
918041558 1:180916901-180916923 CACCCAGCAGGGCCGTCCTGGGG - Exonic
919850328 1:201668057-201668079 CCTCCTGCTGAGGGATCCTGGGG + Intronic
920066425 1:203272916-203272938 CACCCAGGTGCGGACTCCTGCGG + Intronic
920403096 1:205689462-205689484 CACCCAGCTGATGCGGCCTCAGG - Intergenic
921374092 1:214455465-214455487 CACCCAGAGGAGGTATCATGAGG - Intronic
924795969 1:247292389-247292411 CGCCCTGCTGAGGCAGTCTGAGG + Intergenic
1062840625 10:667323-667345 GACCTGGCTGAGGCCTCCTGGGG + Intronic
1063116880 10:3078060-3078082 CAAATAGCTCAGGCATCCTGGGG - Intronic
1067008686 10:42690520-42690542 CAGCCAGCTGTGGCCACCTGTGG - Intergenic
1067738352 10:48876844-48876866 CACACATCTGGGGCACCCTGGGG - Intronic
1067775563 10:49162699-49162721 CACCCAGCAGAGGGCCCCTGAGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068984026 10:63090500-63090522 CTCTCAGCTGGGGGATCCTGTGG - Intergenic
1069756990 10:70779522-70779544 CACCCAAGTGAGGCAGCCTTGGG + Intronic
1069959295 10:72070222-72070244 GACCCAGCTGGGGCCTCCGGAGG - Intronic
1071417322 10:85453425-85453447 CACCAAGCAGAGGGATTCTGAGG + Intergenic
1073363454 10:102918318-102918340 CAGCCAGCTGAGGAACCCCGAGG - Exonic
1075416895 10:122271001-122271023 CTCCCAGCTCTGGCATTCTGGGG - Intergenic
1076653130 10:132003731-132003753 CAGCCAGCTGAGGGTGCCTGGGG - Intergenic
1076716350 10:132366186-132366208 CACCCAGCTGATCCAGGCTGTGG + Intronic
1076866625 10:133169565-133169587 CCCGCAGCAGAGGCCTCCTGGGG - Intronic
1080605371 11:33860832-33860854 TACCCAACTGAGACACCCTGGGG + Intronic
1082987120 11:59178704-59178726 TACACAGCTCAGGCTTCCTGAGG + Intronic
1083245976 11:61428891-61428913 CACCCACCTTTGGCTTCCTGGGG + Intronic
1083729481 11:64645039-64645061 CACCCAGAGGAGGCTTCCGGTGG + Intronic
1083860070 11:65415625-65415647 CCCACAGCTGAGGCTTCATGTGG + Intergenic
1084318295 11:68358564-68358586 ATCCCAGCTCAGGCATCCTGAGG + Intronic
1085781404 11:79412301-79412323 CACCCAGCTGGGCCATCATGAGG - Intronic
1089784547 11:120898659-120898681 CTCCCAGCTGCAGCATCCTGGGG + Intronic
1091055485 11:132414438-132414460 CATTCAGCTGAGGCTTCTTGTGG - Intergenic
1094439291 12:30457051-30457073 CACCAAGCTGCGCCACCCTGAGG + Intergenic
1100739514 12:97575821-97575843 CACCTAGCTGAAGCCTCCCGTGG - Intergenic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1103920096 12:124394921-124394943 CACACAGCTGAAACATCCAGGGG + Intronic
1105442218 13:20424934-20424956 CCTCCAGCTGAGGCATGGTGCGG + Intronic
1106555352 13:30804114-30804136 CACCCAGGAGAGGAATCCCGTGG - Intergenic
1106898205 13:34328333-34328355 CACACAGCTCAGGCAACATGGGG + Intergenic
1111273993 13:85924221-85924243 GACCCAGCTGAGGAATCTTCTGG - Intergenic
1112730158 13:102351741-102351763 CAGCCAGCTGTCACATCCTGAGG - Intronic
1113950171 13:114067099-114067121 CCCCCAGCTGGGGCACTCTGGGG + Intronic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1116905374 14:50398038-50398060 CACCCAGCTAAGCCATACTTGGG + Intronic
1119041257 14:71276704-71276726 GACCCAGGGGAGGCTTCCTGGGG - Intergenic
1121180283 14:91923748-91923770 CACTCAGCAGAGAGATCCTGAGG + Intronic
1121265599 14:92600380-92600402 CACCCCCCTTAGGCATCCTGGGG - Intronic
1122037219 14:98957599-98957621 CACCCACCTGAGACCTCGTGGGG - Intergenic
1122116043 14:99527745-99527767 CACCCAGCTGTGGCTCCCGGTGG - Intronic
1122504983 14:102226624-102226646 CACGCAGCTGAAGCGGCCTGGGG + Intronic
1122809590 14:104281434-104281456 CACCCAGCAGAGCCACCCTCTGG + Intergenic
1122827310 14:104376533-104376555 CACCCAGCTCTGGCACCCCGTGG + Intergenic
1123933760 15:25184267-25184289 CTCCCTGCTTAGGCATCCAGTGG - Intergenic
1127078105 15:55348102-55348124 GTCCCAGCTGAGGCAGGCTGAGG - Intronic
1127898815 15:63326139-63326161 CACCCAGCAGAGGATCCCTGAGG + Exonic
1128107378 15:65054868-65054890 CACCGAGCCTAGGCTTCCTGGGG + Exonic
1130166179 15:81461342-81461364 CACCCAGCTGAGGCTTCTCTAGG + Intergenic
1132085087 15:98901861-98901883 CAACGAGTTGGGGCATCCTGGGG + Intronic
1132689013 16:1174219-1174241 CACCCGGCTGAAGTCTCCTGTGG + Intronic
1133597840 16:7310183-7310205 CTCCCAGCAGAGGCGGCCTGCGG - Intronic
1134979273 16:18594072-18594094 CACCCAGCTCTGGCATGCTCAGG - Intergenic
1135407899 16:22211252-22211274 CAGTCAGCTGAGGAATGCTGGGG - Intronic
1135763593 16:25157447-25157469 CAGGAAGCTGAGGCAGCCTGGGG + Intronic
1136608903 16:31354585-31354607 AACCCGGGTGAGGCACCCTGTGG + Intergenic
1137392566 16:48093443-48093465 CTCCCAGCAGAGGCCTCCTCTGG + Intronic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1141979160 16:87539074-87539096 AGCCCAGCTCAGGCAGCCTGAGG + Intergenic
1142109764 16:88325087-88325109 CATCCAGCTGCGGCATACTCAGG + Intergenic
1142849050 17:2695572-2695594 CACCCAACTGAGTCCTTCTGGGG + Intronic
1143649526 17:8254969-8254991 CTCCCAGCTGAGGCCTGCCGGGG + Intronic
1144852790 17:18252383-18252405 GACCCAGCAGAGGCCTCCTGAGG - Intronic
1145177482 17:20713533-20713555 CAGTGAGCTGAGGCAGCCTGGGG - Intergenic
1146906883 17:36623692-36623714 GCCCCTGCTCAGGCATCCTGGGG + Intergenic
1146934945 17:36807652-36807674 CTCCCAGGTGAGGAAACCTGAGG - Intergenic
1147265535 17:39232184-39232206 GACCCAGCTGAAGCAGCCTGGGG + Intergenic
1147561532 17:41512438-41512460 CACACAGGTGAGACTTCCTGGGG - Intergenic
1150230225 17:63545662-63545684 CAGCCAGGTGAGGCATCCTGGGG - Exonic
1151227891 17:72660258-72660280 CACCCATCAGAGGCAGCCCGAGG + Intronic
1151789218 17:76293463-76293485 CACCAAGCTGACCCATGCTGAGG + Exonic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1151969223 17:77449392-77449414 CTCCCAGCTCAGGAATCCAGAGG + Intronic
1152290240 17:79436218-79436240 CACCCAAGCCAGGCATCCTGTGG - Intronic
1154310950 18:13265824-13265846 CACACAGCTCAGGCCTCCAGGGG + Intronic
1158637880 18:59177345-59177367 GACCCAGAAGAGGCAACCTGGGG - Intergenic
1159776634 18:72610015-72610037 CAACCAGCTGAGGGAGGCTGTGG - Intronic
1160280177 18:77482433-77482455 CACCAAGCTCAGGCATTCTTCGG - Intergenic
1160729686 19:635508-635530 CAGCCCGCTGGGGCACCCTGAGG - Intergenic
1161326277 19:3665742-3665764 CAACAAGCTGAGGCCCCCTGGGG - Intronic
1163153214 19:15427017-15427039 CACCCATCTGAGGGTCCCTGGGG - Exonic
1164445746 19:28316228-28316250 CACCCTGCAGACACATCCTGGGG - Intergenic
1164809511 19:31145049-31145071 CACTCAGGAGAGGGATCCTGAGG + Intergenic
1165100345 19:33435266-33435288 GTCCCAGCTGAGGCTCCCTGTGG - Intronic
1166869728 19:45864148-45864170 CCCCCAGCTGTCGCGTCCTGGGG + Intronic
1167448734 19:49554957-49554979 CCCCCACCTGTGGCAGCCTGAGG - Intergenic
1167503096 19:49858192-49858214 CAGCCAGCTCAGGCCACCTGGGG - Intronic
1167851752 19:52207571-52207593 CAGCCAGCAGACACATCCTGGGG + Intronic
925334108 2:3080462-3080484 CACCCCGGTGAGGCCACCTGGGG - Intergenic
926749361 2:16186206-16186228 CACCCACCAGAGGCAGCCAGGGG - Intergenic
927437650 2:23084016-23084038 CACTCAGAGGAGGCATCCTTGGG + Intergenic
928172622 2:29013050-29013072 CCACCAGCTGAGGCTGCCTGAGG - Intronic
929305842 2:40360632-40360654 CACAGAGCTGAGGCATACAGAGG + Intronic
930116027 2:47718834-47718856 CACCCAGCTGAGCCCTCCGAAGG - Intronic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
931676636 2:64702962-64702984 CAACCAACTGAAGCATCCTGAGG + Intronic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
933875961 2:86622763-86622785 CACCCAGCTGGTGGATCCGGTGG - Exonic
934177095 2:89585457-89585479 CACCCAGGTCAGGGATCCAGGGG - Intergenic
934287402 2:91659816-91659838 CACCCAGGTCAGGGATCCAGGGG - Intergenic
935131672 2:100265328-100265350 CACCCAGCTGACACTCCCTGTGG - Intergenic
938403648 2:131014985-131015007 CACACAGGTGAGACATGCTGAGG - Intronic
941268153 2:163390011-163390033 CACCCAGCTGAGATACCATGCGG - Intergenic
943324297 2:186479649-186479671 CAAGCAGCTGAGGCATCATCAGG + Intergenic
943770515 2:191711435-191711457 CACACAGCTCAGTAATCCTGAGG + Intergenic
944916702 2:204368337-204368359 GACCCAGATGAGGCTTCCTTCGG - Intergenic
946475786 2:220005258-220005280 CACACAGATGAGGCACCCTAGGG - Intergenic
946861200 2:224001696-224001718 CCCCCAGCTGAAGCATCCCCAGG + Exonic
948389489 2:237601788-237601810 CGCCCAGAGGAGGGATCCTGGGG - Intergenic
948462361 2:238136305-238136327 GACCCTCCTGAGACATCCTGAGG - Intergenic
948927655 2:241109621-241109643 CACCCTGCTGACTCAGCCTGGGG - Intronic
1168797804 20:623104-623126 TGCCCAGCTGGGGAATCCTGAGG + Intergenic
1168963745 20:1886463-1886485 CACCCATCTCAGTCACCCTGTGG + Intergenic
1169065278 20:2691709-2691731 GGCCCAGATGAGGCGTCCTGGGG - Intergenic
1169373024 20:5043196-5043218 ACCCCAGCTGAGGATTCCTGGGG - Intergenic
1174552577 20:51372574-51372596 CGCCCAGCCAAGGCAACCTGTGG - Intergenic
1175255623 20:57645180-57645202 CACCCAACAGAGGGACCCTGGGG - Intergenic
1175424495 20:58855019-58855041 AAACCAGCGGAGGCATCCGGAGG - Exonic
1175610223 20:60345070-60345092 CACCCAGCTGAAGCCTCCCTGGG + Intergenic
1180980355 22:19875468-19875490 CACCCACCTGGGCGATCCTGGGG + Intergenic
1181148315 22:20864561-20864583 CACCCCTCTGAGGCAGCGTGTGG + Intronic
1181424170 22:22822359-22822381 CACCCAGCAGAGGCTTCCAGTGG + Intronic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181594406 22:23905012-23905034 GCCCCAGCTGAGCCATGCTGGGG + Intergenic
1181775663 22:25158512-25158534 CAGCCAGGAGAGGCTTCCTGGGG + Intronic
1181806947 22:25380626-25380648 ACCCCAGCTCAGGCATCCTGAGG - Intronic
1182300671 22:29335215-29335237 CATCCACCAGCGGCATCCTGTGG + Intronic
1182431715 22:30302694-30302716 TGCCCAGCTGAGGCCTCCAGAGG - Intronic
1184240693 22:43209999-43210021 CACGCAGCTGAGGCTGCCTCTGG + Intronic
949875516 3:8623855-8623877 CACGCAGCTGGGGTATCCAGTGG - Intronic
952852582 3:37741203-37741225 CACCCTGCTGAGGCTTTCTCTGG + Intronic
953864722 3:46574475-46574497 CCTCCAGCTGAGGAATGCTGGGG - Intronic
954486677 3:50859651-50859673 CACCAAGCTGAGGCTTTGTGTGG + Intronic
957146550 3:76432418-76432440 CACCCACCTAAGGCAATCTGAGG - Intronic
957680628 3:83428576-83428598 GTCCCAGCTGAGGCAGGCTGAGG + Intergenic
961694200 3:128692945-128692967 CACCCAGCTGATGTCTACTGGGG - Intergenic
962311222 3:134328353-134328375 CCCACAGCTGAGTCATCCTTGGG + Intergenic
965752375 3:171989673-171989695 CACCCAGTTGTGGCAGCCTCGGG - Intergenic
966823730 3:183945773-183945795 CACCCAGCTGAGGCAGCAAAGGG + Intronic
967136632 3:186517884-186517906 CATCCATCTAAGGCAGCCTGTGG - Intergenic
968746506 4:2363192-2363214 CACCCAGCTCAGGTCACCTGTGG + Intronic
969129467 4:4981020-4981042 CACACAGCTGGGGCATCCAAGGG + Intergenic
969351946 4:6603251-6603273 CACCCAGCTGACCCTTCTTGGGG + Intronic
975373942 4:73620492-73620514 CGCCCAGCTGAGCCATGCTCTGG - Exonic
981095185 4:140771982-140772004 CACCCAACTGAGGCACCCTTGGG - Intergenic
985477410 5:85950-85972 CTCTGAGCTCAGGCATCCTGTGG + Intergenic
985586938 5:745357-745379 CACCCTGCTGAGCTGTCCTGTGG - Intronic
985775868 5:1841401-1841423 CACCCAGCTGTGCCGGCCTGGGG + Intergenic
989252471 5:39333486-39333508 CACCCAGCTGTTGCAGCTTGAGG + Intronic
995023800 5:107396513-107396535 CACCCAGCTGAGGGCTTCTGAGG + Intronic
995695757 5:114876598-114876620 CACCCAGTTCAGACTTCCTGGGG - Intergenic
995696502 5:114883907-114883929 CTCTCAGCTGAGGCCTCCTGTGG + Intergenic
998410919 5:141910536-141910558 GACCCAGCTCAGGGATGCTGAGG - Intergenic
999101532 5:149029526-149029548 CACACAGGTGAGGCATCTGGGGG + Intronic
999142607 5:149372290-149372312 AACCCAGCCGAAGCTTCCTGGGG + Intronic
999247353 5:150162250-150162272 CACCCAGCCAGGGCCTCCTGGGG - Intergenic
999697939 5:154202847-154202869 CTCCCAGCAGAGTCAGCCTGGGG + Intronic
999810259 5:155120851-155120873 CACCTATCCGAGGCATTCTGAGG - Intergenic
1000518388 5:162269026-162269048 CAGCCAGCAGGGGCAACCTGCGG + Intergenic
1001221208 5:169902592-169902614 CACCCCGCTGAGGCTCCCTGGGG + Intronic
1002451059 5:179318740-179318762 CCCCCAGGGGAGTCATCCTGGGG - Intronic
1002637660 5:180616167-180616189 CCCCCACCTTAGGCATCTTGGGG - Intronic
1004691524 6:17996363-17996385 CAGCCAGGTGTGGGATCCTGGGG - Intergenic
1006454332 6:34123302-34123324 CACCTACCAGAGTCATCCTGTGG + Intronic
1007495805 6:42259696-42259718 CACTCGGCTGATGCTTCCTGGGG + Exonic
1012571356 6:100733510-100733532 CACTTAGCTGAAGCAGCCTGAGG + Intronic
1015519202 6:134114520-134114542 CAGCCACCTGAGGCCGCCTGGGG - Intergenic
1015796399 6:137016238-137016260 CACCCAGCTGGGGCTCCATGGGG + Intronic
1016747530 6:147597041-147597063 CACCCAGCTGAGGAATCACCTGG + Intronic
1021975609 7:26008591-26008613 TTCCCAGCTGAGGAAACCTGGGG + Intergenic
1023213354 7:37832368-37832390 ATCACAGCTGAGGCTTCCTGGGG + Intronic
1023873936 7:44276780-44276802 CACCCAGCTGAGGCAGGCCGAGG - Intronic
1028813875 7:95121714-95121736 CCTCCAGCTGAGTCATCCCGTGG + Intronic
1029613054 7:101637624-101637646 CACCCAGCTGACAAATTCTGGGG + Intergenic
1029683363 7:102128133-102128155 CAGCCGGCTGTGGCATCTTGAGG + Intronic
1029887505 7:103888688-103888710 TACCAAGCTGTGGCATCATGGGG - Intronic
1034091489 7:148368371-148368393 CTCCCAGCTGAGGCCTCCCCTGG + Intronic
1034436038 7:151063174-151063196 CCCCCACCTGAGTCATCCTGCGG - Intronic
1034531700 7:151699922-151699944 CACCCATCTGCGGCCGCCTGTGG - Intronic
1034973139 7:155431607-155431629 CACCCAGCGGCTGCATGCTGGGG - Intergenic
1035037388 7:155904066-155904088 CATCCCTCTGTGGCATCCTGTGG - Intergenic
1035221554 7:157409429-157409451 CAGCCAGCTGAGCCACCCTGGGG - Intronic
1035287999 7:157818588-157818610 CCCCCAGCTGGTGCCTCCTGTGG + Intronic
1035333694 7:158112587-158112609 CTCCCAGCTGGGCCTTCCTGGGG - Intronic
1038488121 8:27950639-27950661 CCACAAGGTGAGGCATCCTGAGG - Intronic
1038586774 8:28796806-28796828 CACCCAACTTAGGCAGCCAGTGG - Intronic
1038748915 8:30278337-30278359 AACCCAGCTGAGGGAGGCTGAGG + Intergenic
1040523905 8:48201403-48201425 CACACAGCTCTGGCAGCCTGGGG - Intergenic
1044944833 8:97380295-97380317 GGCCTTGCTGAGGCATCCTGTGG - Intergenic
1046383004 8:113474737-113474759 CAGCCAGCTTGGCCATCCTGTGG + Intergenic
1047488987 8:125358780-125358802 CACCCAGATGAGGAGTGCTGGGG - Intronic
1048902984 8:139057659-139057681 CACCCAGCTAAGCCATGCTTGGG + Intergenic
1049410667 8:142472476-142472498 CACCCAGCTCAGACACACTGTGG + Intronic
1051334708 9:16055356-16055378 GACCCAGCTCAGCCAGCCTGTGG - Intronic
1052267454 9:26590767-26590789 CACACAGCAGAGGAACCCTGGGG + Intergenic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1054361193 9:64122147-64122169 CACTTAGCTGAGGCATGGTGGGG + Intergenic
1055439563 9:76324806-76324828 CACTCTGTTGAGGCAGCCTGAGG + Intronic
1059108276 9:111530605-111530627 CACCCAGCTGGTGCCTGCTGGGG + Intronic
1060797991 9:126525604-126525626 CTCCCAGCAGAGGCGTCGTGTGG + Intergenic
1060991871 9:127854171-127854193 CGCCCAGCAGAGCCATCCTTGGG - Intronic
1061178367 9:129010448-129010470 CACCCAGCAAGTGCATCCTGAGG + Intronic
1061250959 9:129426154-129426176 CACCCAACAGAGGCTTCTTGGGG - Intergenic
1061937918 9:133868407-133868429 CACCGTGCTGAGGCTCCCTGAGG + Intronic
1061994877 9:134178259-134178281 CATCCAGCTCAGGCACCCGGTGG - Intergenic
1062217556 9:135397466-135397488 CTCCCAGGTGAGGCACTCTGAGG - Intergenic
1062290913 9:135793983-135794005 CACCCAGGTGAGGCAGACTTGGG - Intergenic
1062308361 9:135922055-135922077 CTACCAGCTGGGCCATCCTGGGG - Intergenic
1062525708 9:136977320-136977342 GCCCCAGCTGAGGCAGCGTGGGG - Intergenic
1185747888 X:2586061-2586083 CTCCCACCTGTGTCATCCTGGGG - Intergenic
1186150885 X:6673318-6673340 CACCAAACTGAGACATTCTGGGG - Intergenic
1186994707 X:15107621-15107643 CACACAGCTGGGGTATCCTTTGG - Intergenic
1190357575 X:49619808-49619830 CACCCATCTGAGACAGCCTATGG + Intergenic
1191856160 X:65628501-65628523 CACGCAGCTCAGGGACCCTGGGG + Intronic
1192846027 X:74907922-74907944 CAAGCAGCTGAGACAGCCTGAGG - Intronic
1199668156 X:150118632-150118654 GACCCAGCTGAGGAATACAGCGG - Intergenic
1200034516 X:153319082-153319104 CTCCCAGCTGGGACCTCCTGGGG + Intergenic