ID: 1139649605

View in Genome Browser
Species Human (GRCh38)
Location 16:68355760-68355782
Sequence TGGGTACTCCCACAGCGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139649605_1139649611 1 Left 1139649605 16:68355760-68355782 CCCACCCGCTGTGGGAGTACCCA 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1139649611 16:68355784-68355806 GCCGCAGCCTCTCCGAGCCCTGG 0: 1
1: 0
2: 0
3: 36
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139649605 Original CRISPR TGGGTACTCCCACAGCGGGT GGG (reversed) Exonic
901007316 1:6178364-6178386 AGGGGACTCCACCAGCGGGTCGG + Intronic
901922171 1:12545127-12545149 GGGGAAATCCCACCGCGGGTGGG + Intergenic
902296356 1:15469864-15469886 TGGTGACTCCCACAGCAGCTGGG - Intronic
910064645 1:83139012-83139034 TGGGTACTCCTACATTGGGTGGG + Intergenic
912942361 1:114056430-114056452 TGGGTACCATCCCAGCGGGTAGG + Intergenic
913149318 1:116024902-116024924 TCGGTTCTCCAACAGTGGGTGGG + Intronic
913280356 1:117179594-117179616 TGGGTAAACACACAGGGGGTGGG + Intronic
915488225 1:156236570-156236592 AGGGGACCCCCACAGGGGGTAGG + Intronic
920710020 1:208286335-208286357 TGGCTACTCTCACAGCTGGTGGG - Intergenic
924170171 1:241330767-241330789 TGGGGACTCCAACAGCAGGGAGG + Intronic
1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG + Intergenic
1065003587 10:21359571-21359593 TGGGTAATCTCACAGAGGGAAGG - Intergenic
1067095743 10:43298531-43298553 TGGGTAATCCCACAGGCTGTGGG - Intergenic
1068229729 10:54156560-54156582 TGGGTCCTCCCACAACACGTGGG + Intronic
1071156664 10:82697634-82697656 TGGGTACTCCAACAGCACGTGGG + Intronic
1071389804 10:85161329-85161351 TGGGTACTCTCACAGGCGATTGG - Intergenic
1074678659 10:115881168-115881190 TGGGTATTTCCACTGAGGGTAGG + Intronic
1080341292 11:31268376-31268398 TGTGAACTCCTACAGCGGGAGGG - Intronic
1081066196 11:38542886-38542908 TGGGGACTACTACAGGGGGTGGG - Intergenic
1083995472 11:66269446-66269468 TGGTCACTCCCCCTGCGGGTAGG + Intronic
1085146817 11:74207700-74207722 TGGATTCTCCCACAGCAGCTAGG - Intronic
1090261196 11:125321905-125321927 TGTGTCCTCACACAGGGGGTGGG + Intronic
1091267392 11:134281872-134281894 TGGGGACTCCCACACCAGGTCGG - Intronic
1091275153 11:134344881-134344903 CGGGGACTCCCACACCAGGTCGG - Intronic
1098201234 12:68058094-68058116 TGGGTCCTCCCACAACACGTGGG + Intergenic
1098589403 12:72192219-72192241 TGGGGACTCACTCAGCAGGTTGG + Intronic
1099654428 12:85470556-85470578 TGGGGACTCCAAAAGCGGGGAGG - Intergenic
1101673978 12:106900873-106900895 GGGGTTCTCCCACAGGTGGTGGG + Intergenic
1103969487 12:124661116-124661138 TGTGTCCTGCCACAGCGCGTGGG - Intergenic
1115465448 14:33709639-33709661 TGTGGACTCCCACACAGGGTTGG - Intronic
1119004790 14:70914176-70914198 TGGGGATTCCAAAAGCGGGTAGG + Intronic
1123048146 14:105528264-105528286 TGGGTACTCCAAGAGCGGAGGGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1128718762 15:69930063-69930085 TGGGTCCTCCCACAACACGTGGG + Intergenic
1129516815 15:76162116-76162138 TGGGTCCTCCCACAGCTGAGCGG + Intronic
1131743785 15:95422577-95422599 TGGTCCCTCCCACAGCAGGTGGG + Intergenic
1138805868 16:60087515-60087537 GGGTCACTCCCACAGCAGGTGGG + Intergenic
1138860128 16:60745425-60745447 GGGTTCCTCCCACAGCAGGTGGG + Intergenic
1139649605 16:68355760-68355782 TGGGTACTCCCACAGCGGGTGGG - Exonic
1139967274 16:70752733-70752755 TGGGCCCTCCCACAGCAGATTGG - Intronic
1146390510 17:32417966-32417988 TGGGGACTCCTACAGGGGGAGGG - Intergenic
1146652718 17:34616429-34616451 TGGCCACTCCCTCAGTGGGTGGG - Intronic
1151888745 17:76939675-76939697 TGGGGACTCCCAGAGTGGGGAGG - Intronic
1153297582 18:3562392-3562414 AGGTTCCTCCCACAACGGGTGGG - Intronic
1159031700 18:63238514-63238536 TGGTTATTGCCACAGCTGGTTGG + Intronic
1160385915 18:78496198-78496220 GGAGTCCTCCCACAGCGGCTGGG + Intergenic
1168692812 19:58386907-58386929 TGGCTACTCCCGCGGCAGGTGGG + Intronic
925894066 2:8457731-8457753 TGGGTTCACCCACCGCGGGGAGG - Intergenic
936017744 2:108972473-108972495 CCGGCACTCCCACAGCGGGCAGG - Intronic
1169131149 20:3166978-3167000 TGGGTACCCGCACAGGGGGTGGG - Exonic
1170147288 20:13190138-13190160 TGGGGACTCCAAAAGAGGGTAGG + Intergenic
1172481049 20:35271609-35271631 TGGGTACCCCCACAGCCTGGGGG + Exonic
1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG + Intronic
1175851736 20:62097451-62097473 TGGGTCCTCCCACCAGGGGTGGG + Intergenic
1180086298 21:45509411-45509433 GGGGTGCTCCCGCCGCGGGTAGG - Exonic
1180704024 22:17797830-17797852 TGGGCACAGCCACAGCGGGCAGG + Intronic
1182023179 22:27098151-27098173 TGGGGACTCCCACTGTGGCTGGG - Intergenic
1184164990 22:42721727-42721749 TGGGTGCTACCTCAGCGGGTGGG - Intergenic
1184659738 22:45960317-45960339 TGGGCACTCCCAGAGGGGGCTGG - Intronic
1185245457 22:49770693-49770715 TGGGCGCCCCCACAGTGGGTGGG + Intergenic
949310014 3:2686858-2686880 TGTTTTCTCCCACAGCAGGTAGG - Intronic
950963201 3:17127600-17127622 TGGGTCCTCCCACAACACGTGGG - Intergenic
952990577 3:38827764-38827786 TGGATACTCCCAGAGCAGGAAGG - Intergenic
956956811 3:74350911-74350933 TGGGGACTCCAAAAGCGGGGAGG + Intronic
960058631 3:113296056-113296078 TGGGGACTCCAGCAGCGGGGAGG - Intronic
965651923 3:170943143-170943165 TGGGGACTCCAAAAGCGGGCAGG - Intergenic
966562287 3:181336275-181336297 TGGGGACTCCAAAAGCGGGGAGG + Intergenic
967412384 3:189180172-189180194 TGGGTCCTCCCATAGCATGTGGG + Intronic
972433778 4:39012003-39012025 TGGGTATTCCCAAAGTGGGAAGG + Intronic
973255288 4:48105513-48105535 TGGGAACTCCCAAAGCAGGGAGG + Intronic
973711985 4:53639319-53639341 TGGGTACTACTACAGCAGGGAGG + Intronic
974179856 4:58370670-58370692 TGGGTACTCCCAAAGAGTGGAGG - Intergenic
974507848 4:62800012-62800034 TGGGGACTCCAAAAGAGGGTAGG - Intergenic
978384658 4:108167787-108167809 CGGGTGCTCCCACAGCGGAGCGG - Exonic
979830064 4:125288444-125288466 TGGGTACTCTCAAAGTGGGGAGG - Intergenic
980688937 4:136265900-136265922 TGGGGACTCCCAAAGCAGGTAGG + Intergenic
981097153 4:140793364-140793386 AGGGGACTCCCCCAGCAGGTAGG + Intergenic
983043506 4:162957803-162957825 CAGCTACTCCCACAGCGGGGAGG - Intergenic
983263510 4:165483150-165483172 TGGGGACTCCAAAAGCGGGGAGG - Intronic
985632685 5:1022163-1022185 TTGGGACACCCACAGCAGGTGGG - Intronic
985632696 5:1022204-1022226 CTGGGACACCCACAGCGGGTGGG - Intronic
985632718 5:1022286-1022308 CTGGGACACCCACAGCGGGTGGG - Intronic
985632740 5:1022368-1022390 CTGGGACACCCACAGCGGGTGGG - Intronic
985632762 5:1022450-1022472 CTGGGACACCCACAGCGGGTGGG - Intronic
985632796 5:1022574-1022596 CTGGGACGCCCACAGCGGGTGGG - Intronic
985632808 5:1022615-1022637 CTGGGACGCCCACAGCGGGTGGG - Intronic
985632975 5:1023233-1023255 CTGGGACGCCCACAGCGGGTGGG - Intronic
985632987 5:1023274-1023296 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633009 5:1023356-1023378 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633021 5:1023397-1023419 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633061 5:1023561-1023583 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633124 5:1023807-1023829 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633136 5:1023848-1023870 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633168 5:1023971-1023993 CTGGGACACCCACAGCGGGTGGG - Intronic
985633180 5:1024012-1024034 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633202 5:1024094-1024116 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633254 5:1024299-1024321 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633276 5:1024381-1024403 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633298 5:1024463-1024485 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633342 5:1024627-1024649 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633354 5:1024668-1024690 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633386 5:1024791-1024813 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633406 5:1024873-1024895 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633468 5:1025119-1025141 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633655 5:1025858-1025880 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633734 5:1026146-1026168 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633765 5:1026270-1026292 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633798 5:1026393-1026415 CTGGGACGCCCACAGCGGGTGGG - Intronic
985633828 5:1026516-1026538 CTGGGACACCCACAGCGGGTGGG - Intronic
988577843 5:32444257-32444279 TGGATTCACCCACAGCGGGGCGG - Exonic
993555041 5:89325926-89325948 TGGGGACTCCAAAAGCGGGGAGG - Intergenic
994047456 5:95325924-95325946 TGGGGACTCCAAAAGGGGGTAGG - Intergenic
997292367 5:132747296-132747318 TGGGCACTCGCCCCGCGGGTGGG - Intergenic
1006444959 6:34074916-34074938 TGGGTACAGCCACTGAGGGTGGG - Intronic
1007763902 6:44150060-44150082 TGGGCAGTCCCACAGCTGGTAGG + Intronic
1011612790 6:89169511-89169533 TGGGAACTCCAAAAGGGGGTGGG - Intergenic
1018986683 6:168643196-168643218 TGGGTCCTCCCACAGCTGGCTGG + Intronic
1019296881 7:282337-282359 TGGGGACTCCCAGAGCAGGGAGG + Intergenic
1019296896 7:282387-282409 TGGGGACTCCCAGAGCGGGAAGG + Intergenic
1019296911 7:282437-282459 TGGGGACTCCCAGAGCGGGAAGG + Intergenic
1023109472 7:36794901-36794923 TTGTTACTCCCACGGCAGGTGGG - Intergenic
1027279467 7:76595736-76595758 TGGGTACTCCTACATTGGGTGGG - Intergenic
1032090419 7:128908953-128908975 TGGGGGCTCCCACATTGGGTGGG + Intronic
1038317720 8:26501951-26501973 CGGGTAGTCCCACAGCAGGAAGG - Intronic
1039664156 8:39504247-39504269 TGGGTACACCCTTAGCAGGTAGG + Intergenic
1043780549 8:84328761-84328783 TGGGGACTCCCAGAGTGGGGAGG - Intronic
1044542291 8:93421264-93421286 TGGGTACAGCCTCAGTGGGTGGG - Intergenic
1044695128 8:94915075-94915097 TGGGGACTCCAAAAGCGGGGAGG - Intronic
1052337128 9:27331388-27331410 TGGCTACCTCCACAGCGAGTGGG - Intronic
1059536086 9:115082256-115082278 TGGATAGTCACACAGCTGGTTGG + Intronic
1059753493 9:117271357-117271379 TGGGTGCTCCCACAACATGTGGG + Intronic
1188026250 X:25212755-25212777 TGGGGACTCCAAAAGCGGGGTGG - Intergenic
1189726837 X:43975798-43975820 TGGGTAGTCCCAAAGCAGGTGGG + Intergenic
1189766425 X:44377164-44377186 TGGGAACTACCAAAGCGGGGAGG + Intergenic
1191987635 X:66999903-66999925 GGGTTACTCCCACAGCATGTGGG + Intergenic
1199005580 X:142692818-142692840 TTGGTATTCCCGCAGGGGGTAGG - Intergenic