ID: 1139649697

View in Genome Browser
Species Human (GRCh38)
Location 16:68356124-68356146
Sequence CCTGAGCTGTGATCCAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139649697_1139649702 1 Left 1139649697 16:68356124-68356146 CCCTTGTTGGATCACAGCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1139649702 16:68356148-68356170 AGATGGGAGCTTACTTCCTGTGG 0: 1
1: 0
2: 2
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139649697 Original CRISPR CCTGAGCTGTGATCCAACAA GGG (reversed) Intronic
901763994 1:11488428-11488450 CCTGAGCTGTCACTCACCAAGGG + Intronic
902930831 1:19730355-19730377 GCAGAGGTGTGATACAACAAAGG - Intronic
903587645 1:24428404-24428426 TCTGACCTATGATCAAACAAAGG - Intronic
906101343 1:43265534-43265556 CCTGATAGGTAATCCAACAAAGG + Intronic
906523924 1:46483458-46483480 CCTGAGCTGTGGTCCTCAAAGGG + Intergenic
907015026 1:51004383-51004405 CCTGAGATGTCATCCAGGAATGG + Intergenic
909810949 1:79931291-79931313 CCTCTGCTGTGATTCACCAATGG - Intergenic
911656581 1:100450686-100450708 CGTGAGCTTTGAACCAGCAATGG - Intronic
920420830 1:205832242-205832264 GCTGAGCTGTTATCCTAGAATGG + Intronic
920453803 1:206082136-206082158 AGTGAGCTGTGATACATCAACGG + Intronic
920511339 1:206554591-206554613 CCTGAGATGTGATCGCACAAAGG - Intronic
923929491 1:238677781-238677803 ACTAATCTGTGAGCCAACAACGG + Intergenic
924792780 1:247268877-247268899 CCAGAGCTTTGAGCAAACAAAGG - Intergenic
1062933410 10:1367790-1367812 TCTGATCTGAGATCCAGCAAAGG - Intronic
1065959814 10:30725417-30725439 CCAGAGCTGTGAGACAATAAAGG + Intergenic
1068447204 10:57138545-57138567 CCTCAGCTGTGATTCACCTATGG - Intergenic
1068900362 10:62261872-62261894 TCAGAGCTGTGAATCAACAAAGG + Intronic
1071251402 10:83823347-83823369 CCTGAGCTGTAATCCAGGAAAGG + Intergenic
1071523172 10:86343582-86343604 GCAGAGCTCTGAGCCAACAATGG - Intronic
1073073242 10:100807962-100807984 CCTGAGCCATAAACCAACAAAGG + Intronic
1073275305 10:102305111-102305133 TCTGATCTGGGATCCAGCAATGG + Intronic
1073785045 10:106879746-106879768 CCTTAGCTGTCAGCCAGCAAAGG + Intronic
1074514441 10:114152283-114152305 AGTGAGCTGTGATCCCACCATGG + Intronic
1076696273 10:132248852-132248874 CCCGAGCTGTGAACCAGCAAGGG + Intronic
1077191675 11:1258332-1258354 CCTCAGCTGTGTTCGTACAATGG + Exonic
1079057820 11:17222155-17222177 GCTGAACTGTGGTCCAACAGGGG + Intronic
1079975415 11:27084753-27084775 CCTGAGCTGTATTTCAAAAAAGG - Intronic
1085454246 11:76656786-76656808 CCACAGCTGTGATCCCACACAGG - Intergenic
1085515228 11:77107689-77107711 CCTGGGATGTGATCCACCAACGG - Intronic
1087137040 11:94731417-94731439 CCTGGGATGAGATCCAAGAAAGG + Intronic
1088666364 11:112097878-112097900 CATGCGCTGTGATGTAACAAAGG + Intronic
1089361442 11:117890463-117890485 AATGAGCTGTGATCCAACCACGG - Intergenic
1091665441 12:2415433-2415455 CCTGAGCTGTGATCATGAAAAGG + Intronic
1093117992 12:15234680-15234702 CCTCAGCTGTGATCCAATCAGGG - Intronic
1098664354 12:73142086-73142108 TCTGAGTTGTGTTCAAACAATGG - Intergenic
1101566399 12:105909917-105909939 CCTCAGTTGTGATACAACATGGG + Intergenic
1104504450 12:129318482-129318504 CCTGTGATGTGATCCATCTATGG + Intronic
1105944571 13:25178234-25178256 CCTCAGCTGTGGTGCAACATAGG - Intergenic
1107826346 13:44332098-44332120 CCTGGGCTGGGATCCAACAGGGG + Intergenic
1109688524 13:65853240-65853262 CAGGAGCTGTTATCCAATAAAGG + Intergenic
1112858681 13:103803453-103803475 CCTGAACTATGATCTAATAAGGG - Intergenic
1113462315 13:110490929-110490951 TCGGAGCTGTGGTCCCACAATGG + Intronic
1114661686 14:24350205-24350227 CCTGAGCTTGGATTTAACAAAGG + Intergenic
1115525054 14:34271537-34271559 CCAGACCTGTGATCCAACTCTGG - Intronic
1115679544 14:35720874-35720896 AGTGAGCTATGATCCAACAAAGG + Intronic
1120821313 14:88914352-88914374 CCTCAGCTGTGATACAAAATGGG - Intergenic
1121488754 14:94342923-94342945 CCTCAGCTGTGTTCCTGCAAAGG - Intergenic
1122314274 14:100816483-100816505 ACTGAGCTCAGAGCCAACAAGGG - Intergenic
1123765384 15:23472700-23472722 CCTGTGCTGTGATTCACCTAAGG + Intergenic
1125005690 15:34814069-34814091 CTTCAGCTGTGATCCACAAAGGG + Intergenic
1125855553 15:42946179-42946201 CCTGAGCCGTGATCGTACCACGG - Intronic
1129843307 15:78756893-78756915 CCTGAGCTGTCAGCCAAGACGGG - Intergenic
1135046759 16:19162304-19162326 CATGAGCTGTGATCCCACAAGGG - Intronic
1137495354 16:48965225-48965247 CAAGAGCTGTGATGCCACAAAGG + Intergenic
1138891782 16:61151787-61151809 CCTCATCTGTGATCCAAGTAAGG - Intergenic
1139557732 16:67723423-67723445 CCTGAGTTGTGAGCAACCAAAGG + Exonic
1139649697 16:68356124-68356146 CCTGAGCTGTGATCCAACAAGGG - Intronic
1140525129 16:75616500-75616522 CCTGAGTTGTTATCCACAAAAGG + Intronic
1141435556 16:83997801-83997823 CCTGGACTTTGATCCAAAAAAGG + Intronic
1141569474 16:84925532-84925554 CTTGACCTGTTATCCAAGAAAGG + Intergenic
1141785598 16:86198491-86198513 CCTGTCCTGTGATTCCACAAAGG - Intergenic
1141946095 16:87311036-87311058 CCTGGGCTCTGCTCCCACAAAGG - Intronic
1143447530 17:7018220-7018242 CCTGAGCTGAGTTCCTACAGAGG - Intergenic
1147158075 17:38554837-38554859 ATTGAGCTGAAATCCAACAATGG - Intronic
1148972238 17:51493649-51493671 CCTGTTCTGTGCTTCAACAATGG + Intergenic
1149956635 17:61058707-61058729 CCTATACTGTGATCAAACAATGG - Intronic
1152288891 17:79427631-79427653 CCTTAGCTGTGTCCTAACAAGGG - Intronic
1152638869 17:81441302-81441324 CCTGAACTGTGCACCAAAAATGG + Intronic
1157434486 18:47656903-47656925 GCTGAGCAGTGATCCAACTGAGG + Intergenic
1159287780 18:66375405-66375427 CCTCTGCTGTGATTCACCAATGG - Intergenic
1159449862 18:68586192-68586214 CCTTAGGTGTGTTACAACAATGG + Intergenic
1159711295 18:71764047-71764069 CCTCAGCTGTGATTCACCTATGG - Intronic
1161393209 19:4031931-4031953 CCAGAGCTGGGATCCAAGGATGG + Intronic
1161568192 19:5015137-5015159 CCTGAGCTGAGAGCCAGCACCGG + Intronic
1161805394 19:6440545-6440567 CCAGAGCTGTGTTCCTCCAAGGG - Exonic
1164604111 19:29583754-29583776 CATGAGGTGTGATCCAAGCAAGG - Intergenic
1167924001 19:52808754-52808776 AGTGAGCTGTGATCCCACCAGGG + Intronic
1168617322 19:57849358-57849380 CCAGAGCTCTCAGCCAACAATGG - Intronic
926406339 2:12556921-12556943 CCTGACCTATGAGTCAACAAGGG + Intergenic
926808592 2:16736198-16736220 CCACAGCTGTGATCCAAGGAGGG - Intergenic
931256158 2:60574960-60574982 CCTTAGCTGTGATCCCAGATCGG + Intergenic
934145816 2:89093068-89093090 CCTGAGCTGTGATGCAAGCGGGG - Intergenic
934223444 2:90107500-90107522 CCTGAGCTGTGATGCAAGCGGGG + Intergenic
941015259 2:160349021-160349043 TCTGCTCTGTGATCCAAAAAAGG - Intronic
944208245 2:197179911-197179933 CCTGGGCAGGGGTCCAACAAGGG + Intronic
944396992 2:199279794-199279816 CATAAACTGTGATCCAAAAAAGG + Intronic
946994484 2:225375784-225375806 TCTGGGATCTGATCCAACAAGGG - Intergenic
948807387 2:240458916-240458938 CCTGAGCTGTGCTCCACCCTGGG + Intronic
1170116398 20:12864980-12865002 CCTGAGCTGTTATCCCCCCATGG + Intergenic
1176911621 21:14572060-14572082 CCTGAGCTGTGTGGCCACAATGG - Intronic
1182361791 22:29750781-29750803 CCTGAGCTGTGTTCCCCCATTGG - Intronic
1183608066 22:38878552-38878574 CATGAGCTGTGTCCCAACTAGGG - Intergenic
1183653054 22:39169996-39170018 CCTGAGCTGAGAGCCACCGAGGG - Intergenic
951059689 3:18190649-18190671 TCTGAGCTGTGAGCTAAAAAAGG - Intronic
954824838 3:53363612-53363634 ACTGAGCTGTGAAACAAGAAAGG + Intergenic
959373397 3:105558054-105558076 ACTGAGCTGTGACCAAAGAAGGG + Intronic
959802464 3:110512022-110512044 CCTGTGCTGTGAACCATCTATGG + Intergenic
960497637 3:118394679-118394701 CCAGAGCTGTGTTCCTCCAAGGG - Intergenic
961558971 3:127715806-127715828 CCTGAGCTGTGAGCACACCAGGG + Intronic
964566130 3:158055272-158055294 CCTGAGCTGTGCACCATGAATGG - Intergenic
964934634 3:162067310-162067332 ATTGAGCTGTGGTCCAACAGTGG - Intergenic
965172589 3:165286173-165286195 CAGTAGCTATGATCCAACAAGGG - Intergenic
973670584 4:53213409-53213431 CCTGACCTTTGATACAAAAAGGG + Intronic
976079251 4:81336474-81336496 CCTAAGCAGTGATCCATCAGTGG + Intergenic
980381294 4:132021588-132021610 ACTGAGCTGTGATACAACTTTGG - Intergenic
984220979 4:176974434-176974456 CATGAGAAGTGAGCCAACAAGGG - Intergenic
990695706 5:58414478-58414500 CCTCAGCAGTGATCCATCAGAGG + Intergenic
993250274 5:85512942-85512964 CCTGTGATGTGAACCAACTATGG + Intergenic
993492671 5:88570698-88570720 CCTGAGCTGTGATGCAAGTGGGG + Intergenic
995674575 5:114648940-114648962 GCTGGGATGTGATCCACCAAGGG + Intergenic
996551020 5:124730347-124730369 ACAGAGCTGAAATCCAACAAGGG + Intronic
997474336 5:134133952-134133974 CCTGAGCTGTGCTGCAACCTGGG + Intronic
997521857 5:134528095-134528117 CCTGAGCTCTGATCCCAGACAGG + Intronic
1001589371 5:172855082-172855104 CCTGGGCTGTGTTCCCCCAACGG + Intronic
1004262580 6:14121039-14121061 TCTTAACTGGGATCCAACAAAGG + Intronic
1004828312 6:19448663-19448685 CCTGTGATGTGATCCCTCAAAGG + Intergenic
1005690122 6:28296896-28296918 CCTGAGCTGAGTTCCCACAGAGG - Exonic
1007335859 6:41154442-41154464 CCTGAGCACTGAGCCAACCAGGG - Intergenic
1008775342 6:55031665-55031687 CCTGTGCTGTGAACCATCTATGG + Intergenic
1009295384 6:61940789-61940811 GCTGAGATGTGATCCAAGCATGG + Intronic
1010854111 6:80815491-80815513 CCTGAGTTGTGATTCACCTATGG + Intergenic
1012547312 6:100434248-100434270 CCTGAGCTGTAACCCTGCAAGGG + Intronic
1013691243 6:112647425-112647447 TCTGAGCTGTGATTCAAATATGG - Intergenic
1018228307 6:161651835-161651857 CCTGAGCTGGGACCCACAAATGG + Intronic
1022976814 7:35566282-35566304 CCTGAACTGATATCTAACAAGGG + Intergenic
1025027786 7:55532270-55532292 CCTGAACAGTGACCCAACCATGG + Intronic
1029333211 7:99877798-99877820 CATGAGCTGCAATCCCACAAAGG + Intronic
1029846390 7:103416425-103416447 ACTGAACTGTGAGCCAGCAAAGG - Intronic
1033076248 7:138252970-138252992 CCTCCGCTGTGATTCACCAATGG - Intergenic
1033926783 7:146471428-146471450 TCTCAGCTGTGAATCAACAATGG + Intronic
1037293489 8:17375881-17375903 ACAGAGCTGTCATTCAACAAAGG - Intronic
1040849962 8:51889825-51889847 CCTGAGCTGTGCACCACAAATGG + Intronic
1041100804 8:54395045-54395067 CCTGAGCTGTGCTCCCCCACGGG + Intergenic
1041735443 8:61106156-61106178 CCTGAACTGAGAGCCTACAAAGG - Intronic
1044810319 8:96054362-96054384 CCTCAGCTGAGACCCAAGAAGGG - Intergenic
1045614696 8:103896162-103896184 CCTAAGGCGTGGTCCAACAAAGG - Intronic
1047633051 8:126729162-126729184 GCAGAGCTGGGATCCAACTAGGG + Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1052442278 9:28512358-28512380 CCTCCGCTGTGATTCAACAATGG + Intronic
1053407405 9:37889410-37889432 CCTTACCTGTGTTCCCACAATGG - Intronic
1059666504 9:116451118-116451140 CCTGAGCTTAGAACCAACACTGG - Intronic
1060394688 9:123307210-123307232 AACTAGCTGTGATCCAACAAGGG + Intergenic
1060803746 9:126562143-126562165 CCAGAGCTGTCATCTAACTAAGG + Intergenic
1062077455 9:134598637-134598659 CATGGGCTGTGATCCACCGAGGG - Intergenic
1062410864 9:136423585-136423607 CCTGAGCTGGGAGGCAGCAAAGG + Exonic
1185484303 X:470741-470763 CGTGAGCTGTGATCACACCAGGG - Intergenic
1189053687 X:37675154-37675176 TCTGTGCTGTGAGCAAACAAGGG - Intronic
1190721646 X:53153686-53153708 CCTGAGCTGTGGTTCACCTATGG + Intergenic
1190733377 X:53239166-53239188 CAGGAGCTGGGATCCAAGAAGGG + Intronic
1193128099 X:77891229-77891251 ACTGAGCTGGGATCCCACACTGG - Intronic
1197591857 X:128419309-128419331 CCTCTGCTGTGATTCACCAATGG - Intergenic
1198220126 X:134591122-134591144 CCTGAGCTGTGCTCGAATGAGGG - Intronic
1198570340 X:137948303-137948325 CCTCACCTGTCCTCCAACAAAGG - Intergenic
1202337405 Y:23826382-23826404 CCTGACCTGTAAACCAAGAATGG + Intergenic
1202533361 Y:25843689-25843711 CCTGACCTGTAAACCAAGAATGG - Intergenic