ID: 1139657143

View in Genome Browser
Species Human (GRCh38)
Location 16:68395967-68395989
Sequence CAACTCAGTGTGCCTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139657137_1139657143 -5 Left 1139657137 16:68395949-68395971 CCTGTCCCAGGGGTGCCTCAACT 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 239
1139657138_1139657143 -10 Left 1139657138 16:68395954-68395976 CCCAGGGGTGCCTCAACTCAGTG 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139657143 Original CRISPR CAACTCAGTGTGCCTGGCCT GGG Intronic
900093821 1:932306-932328 CTCCTCCGTCTGCCTGGCCTCGG + Intronic
900140675 1:1138238-1138260 CAAGCCACTGTGCCCGGCCTGGG + Intergenic
900829152 1:4951872-4951894 CAATTCAGTATGTCTGGCGTGGG - Intergenic
901206970 1:7503030-7503052 CCACTCTGTGTGCCAGGCCCCGG - Intronic
902112991 1:14098755-14098777 CAACCCTGTGTGGCTGCCCTGGG + Intergenic
903360286 1:22772667-22772689 AAACTCAGTCAGGCTGGCCTGGG + Intronic
903770774 1:25762982-25763004 TGAGTCACTGTGCCTGGCCTAGG - Intronic
904368663 1:30034780-30034802 CATCACAGGGTGCCCGGCCTGGG + Intergenic
904786135 1:32984426-32984448 GAACTGACTGTGCCTAGCCTAGG + Intergenic
904789846 1:33011274-33011296 CAGCTATGTGTGCCTGGTCTGGG - Intronic
906543757 1:46607410-46607432 CATCTCAGGTTGCCTGGCATTGG - Intronic
906599560 1:47113305-47113327 CAGCTCAGCATGCCTCGCCTGGG + Intronic
907427294 1:54388424-54388446 CCACACACAGTGCCTGGCCTGGG + Intronic
908602654 1:65757706-65757728 TAAGCCATTGTGCCTGGCCTTGG + Intergenic
910988459 1:93029654-93029676 CAAGCCAGTGTGCCTTGGCTTGG + Intergenic
912972038 1:114292693-114292715 CAACTCTGTCTTCCTGTCCTTGG - Intergenic
914689401 1:150012036-150012058 CAAGTCAGAGTGCCTTGCATGGG + Intergenic
915226368 1:154414671-154414693 CAACAAAGTGTTCCTGGCCAAGG - Intronic
915468864 1:156114170-156114192 CATCTCAGTGTGCCAGGAGTGGG - Intronic
915565923 1:156712624-156712646 CAACTGACTGTCCCTGCCCTGGG - Intergenic
916560572 1:165931197-165931219 CAGCTCCCTGAGCCTGGCCTGGG - Intergenic
922738825 1:228004632-228004654 CAAGTCAGTGGGGCTGGGCTGGG - Intergenic
923189365 1:231605816-231605838 CAGCTCATAGTGCCTGGCTTGGG + Intronic
924710876 1:246529154-246529176 CAACTGAGGGTTCCTGGCCAAGG + Intergenic
1062933756 10:1369785-1369807 AAGCTCAGTGTGCCTGCTCTAGG - Intronic
1063498688 10:6533478-6533500 CGAGCCACTGTGCCTGGCCTGGG + Intronic
1063977581 10:11429696-11429718 AACCTCAGTGGGCTTGGCCTTGG + Intergenic
1066269814 10:33811171-33811193 CAGCTCAGTGCCCCTGACCTTGG + Intergenic
1066552592 10:36576082-36576104 GTACTCAGGGTGCCTTGCCTTGG + Intergenic
1067217937 10:44318002-44318024 CAACACAGGGTGCCTGGCTCAGG - Intergenic
1067683915 10:48456256-48456278 TATCTCAGTGAGCCTAGCCTGGG - Intronic
1068144234 10:53045653-53045675 TAAGCCACTGTGCCTGGCCTAGG + Intergenic
1068575666 10:58681629-58681651 TGACTCAGTGTGCCTGGAATTGG + Intronic
1069599108 10:69692082-69692104 TAAGCCACTGTGCCTGGCCTTGG + Intronic
1069622140 10:69844233-69844255 CAGCTCAGTGTGGCTGTCCAGGG + Intronic
1070966986 10:80535973-80535995 AACCTGGGTGTGCCTGGCCTGGG - Intergenic
1071109259 10:82136070-82136092 CAAGTCAGTGTTACTGGGCTTGG - Intronic
1071871185 10:89796424-89796446 CCACTCAGTGTGCTAGGGCTGGG + Intergenic
1072135322 10:92539956-92539978 TGAGTCACTGTGCCTGGCCTAGG - Intronic
1073158327 10:101367353-101367375 CCACTCACTGCGCCTGGCCTAGG + Intronic
1074696082 10:116051148-116051170 CAACTTCATGTGCCTAGCCTGGG - Intergenic
1075016735 10:118915184-118915206 CATCTCTGTGTGCCTGCCCTGGG - Intergenic
1075671590 10:124267062-124267084 CAGCTGTGTGTGCTTGGCCTGGG - Intergenic
1075794107 10:125106713-125106735 CAACACTGTGTGGCCGGCCTGGG - Intronic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1077929593 11:6717194-6717216 CAACTCATTGTCCCTATCCTTGG + Intergenic
1079346430 11:19656697-19656719 CAAGTCAGTGGGTCTGGGCTGGG - Intronic
1081787644 11:45758532-45758554 TGAGCCAGTGTGCCTGGCCTAGG - Intergenic
1083859831 11:65414152-65414174 CAAGCCACTGTGCCTGGCCTGGG - Intergenic
1084405268 11:68968426-68968448 CAACCCTGTGGGCCTGGCCGTGG + Intergenic
1084867699 11:72073073-72073095 TAAGCCATTGTGCCTGGCCTAGG - Intronic
1084904218 11:72333752-72333774 CAACTCAGTGGGGCTGGGCCAGG - Intronic
1085648848 11:78248429-78248451 TGACTCAGTAAGCCTGGCCTAGG - Intronic
1090023853 11:123150984-123151006 CGAGCCACTGTGCCTGGCCTGGG + Intronic
1090449205 11:126791336-126791358 CAATTCATCGTCCCTGGCCTGGG + Intronic
1096756516 12:53804146-53804168 CAACACAGTGTGCCTGCTATTGG + Intergenic
1096898798 12:54852967-54852989 CAAGTCAGTGTCCTTGTCCTGGG - Intronic
1098314474 12:69178502-69178524 CAACTCAGTGTTGCTGGGCGTGG - Intergenic
1099092395 12:78329513-78329535 CAAATCTGTGTGCCTAGACTAGG - Intergenic
1100619527 12:96257774-96257796 CAACTGAGTCAGCCTGGACTTGG - Intronic
1102308735 12:111827126-111827148 CACCTGAGTGAGGCTGGCCTTGG + Intergenic
1104038273 12:125113534-125113556 CAACTCTGTGTGTCTGGCAGGGG - Intronic
1106540528 13:30686304-30686326 CACCTCATTGTGCCTGGCTCAGG + Intergenic
1107840369 13:44451105-44451127 CACCTTAGGGTGCCTGGCATTGG - Intronic
1108350676 13:49588166-49588188 TGACCCACTGTGCCTGGCCTAGG - Intergenic
1108353473 13:49608335-49608357 TAAGCCACTGTGCCTGGCCTTGG + Intergenic
1110399242 13:75070643-75070665 CAACCCATGGGGCCTGGCCTTGG + Intergenic
1112336403 13:98520701-98520723 GAACTCAGTGTGTCTCACCTTGG - Intronic
1112436537 13:99394725-99394747 CACCTCCATGTGCCTGTCCTAGG + Intergenic
1116012310 14:39366224-39366246 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1122187534 14:100012640-100012662 CAATTCTGTGTGCCAGGCCTGGG + Intronic
1122266269 14:100548360-100548382 CAGCCCATTGTGCCTGCCCTAGG - Intronic
1122834947 14:104426198-104426220 CAACTCAGTTTCCCTGGGCTGGG + Intergenic
1124587719 15:31024967-31024989 CAACTGTGGGTCCCTGGCCTCGG - Intronic
1124886690 15:33693905-33693927 CAACACAGAGTGCCCGGACTAGG + Intronic
1128257967 15:66212301-66212323 CACCTCTGTGTGCTGGGCCTGGG - Intronic
1129139239 15:73582120-73582142 CAAGACACTGCGCCTGGCCTTGG + Intronic
1129221561 15:74134443-74134465 CTACTCCGTGTGCCTGGCGCTGG + Exonic
1129614192 15:77084812-77084834 CAACTGTGTGACCCTGGCCTAGG + Intergenic
1129656147 15:77526899-77526921 CATTTCTGTGTGGCTGGCCTGGG + Intergenic
1129834654 15:78694545-78694567 CAGCTCAGTGTTCCTGGTCTTGG - Intronic
1132028456 15:98421663-98421685 CATCTCAGTGAGACCGGCCTCGG + Intergenic
1133144299 16:3772491-3772513 CAGCTCAGTGTGTTTGCCCTGGG - Intronic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1135674962 16:24407360-24407382 TAAGCCACTGTGCCTGGCCTGGG + Intergenic
1138950783 16:61909902-61909924 CAAGCCAGTGTTCATGGCCTTGG + Intronic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1139777926 16:69328880-69328902 CAGCTCAGTCTGCCATGCCTTGG + Exonic
1139966140 16:70746468-70746490 CCACTCTGTGTGCCAGGCCACGG - Intronic
1140647110 16:77044630-77044652 CAAGTCAGTGTGCTTGGCAGAGG - Intergenic
1141685579 16:85568006-85568028 CGAGCCACTGTGCCTGGCCTGGG + Intergenic
1141798223 16:86288839-86288861 GAACTCAGCCTGCCTGCCCTGGG + Intergenic
1142113987 16:88346962-88346984 TACCTCAGTGTGCCTCTCCTGGG - Intergenic
1143832293 17:9662135-9662157 CATCTCAGTGTGGCTTGCTTGGG + Intronic
1144729846 17:17520024-17520046 CAGCTCAGCGTGCCAGCCCTGGG + Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1146826131 17:36024661-36024683 CCACCCAGTGTGCCTACCCTTGG + Intergenic
1149392363 17:56204622-56204644 CAAGTCACTGTGCCTGGCTCAGG + Intronic
1150988206 17:70223983-70224005 TAAGCCACTGTGCCTGGCCTAGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152439408 17:80296489-80296511 AAACACAGTGTGACTGTCCTGGG + Intronic
1153713423 18:7822257-7822279 CACTTCAGAATGCCTGGCCTGGG + Intronic
1159460087 18:68713308-68713330 CAAATGAGCGTGGCTGGCCTGGG + Intronic
1161423317 19:4187699-4187721 CACCTCTTTGTGCCTGGCCTGGG + Intronic
1161456442 19:4372089-4372111 TGACACAGTGTGCCTGGCCAAGG + Intronic
1162475140 19:10895386-10895408 CAAGCCACTGTGCCTGGCCTAGG + Intronic
1163546728 19:17945149-17945171 CCCCACTGTGTGCCTGGCCTTGG + Intergenic
1163746401 19:19051331-19051353 CAACTCAGTGTCCCTGCCGAAGG - Intronic
1164725089 19:30460846-30460868 CGACTCAGGGTGCAGGGCCTGGG + Intronic
1165108191 19:33486713-33486735 CTACTCGGGGTGCCTGGCCTGGG - Intronic
1165771127 19:38380919-38380941 CAACAAAGTGTTCCTGGCCAAGG + Exonic
1166125444 19:40713058-40713080 GAAGCCACTGTGCCTGGCCTGGG - Intronic
1166966212 19:46530699-46530721 AGACTCACTGTACCTGGCCTGGG - Intronic
1166983085 19:46643241-46643263 TAAGCCAGTGTGCCTGGCCAAGG - Intergenic
1167605563 19:50479967-50479989 CGACTCAGGTTGGCTGGCCTGGG + Intronic
925163101 2:1700615-1700637 CCTCCCACTGTGCCTGGCCTTGG - Intronic
925577665 2:5377229-5377251 CTGCACTGTGTGCCTGGCCTGGG + Intergenic
926251442 2:11157395-11157417 GAAGTCTGTGTGCCTGGCCCTGG - Intronic
926272763 2:11378979-11379001 GGACTCAGTGAGCCTGGCTTAGG - Intergenic
926300688 2:11599943-11599965 CATCTCCGTGAGACTGGCCTAGG + Intronic
929393099 2:41494304-41494326 CAACTGAGGGTTCCTGGCCAGGG + Intergenic
929942883 2:46348171-46348193 CAGCTCAGTGGGCCTGGGGTTGG + Intronic
933080378 2:77977559-77977581 CTAATCAGTGTGATTGGCCTGGG - Intergenic
933468852 2:82693966-82693988 CAACTGAGTGTCCCTAGACTTGG + Intergenic
934120727 2:88836556-88836578 TCCCTCAGTGTGCATGGCCTTGG - Intergenic
934667146 2:96180136-96180158 TAAGCCACTGTGCCTGGCCTAGG - Intergenic
935737038 2:106114547-106114569 CAACGCAATGTGCCTGGCAGGGG + Intronic
937425458 2:121795163-121795185 CAACGCAGTGGGCCATGCCTGGG + Intergenic
938897832 2:135769886-135769908 CTATTCAGTGTGGCAGGCCTAGG + Intronic
940457298 2:153916438-153916460 CAAGTCACTGTGCCCAGCCTAGG + Intronic
941879974 2:170471331-170471353 TGACCCACTGTGCCTGGCCTGGG + Intronic
947666694 2:231910493-231910515 CAAACCAATGTGGCTGGCCTGGG - Intergenic
948140820 2:235670627-235670649 CAGCTCCGGGAGCCTGGCCTGGG + Intronic
948280596 2:236744798-236744820 CCACTCAGTGTCCCTGCCATGGG + Intergenic
948570917 2:238916703-238916725 CAACCCAGTGGGCCTGCCCTGGG + Intergenic
948802198 2:240438018-240438040 CAACACAATCTGCCTGTCCTGGG - Intronic
1168809182 20:692838-692860 CAACTGAGAGTTCCTGGCCAGGG - Intergenic
1169197807 20:3692828-3692850 CATCCCAGTGGGCTTGGCCTAGG + Intronic
1170240772 20:14164343-14164365 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1170625385 20:18026347-18026369 CAACTCAGTGGGTCTGGGGTAGG + Intronic
1170767149 20:19300017-19300039 CCTCTCATTGTGCCTGGCTTTGG - Intronic
1171002983 20:21433611-21433633 CAACTCATTATGCCAGGCTTGGG + Intergenic
1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG + Intronic
1172393618 20:34583515-34583537 CAACTGTGTGGGCCTGGCTTAGG + Intronic
1173249556 20:41357443-41357465 CAACTGTGAGTGCCTGGGCTGGG + Exonic
1173436887 20:43041503-43041525 CAACTCAATGTTGCTGGCTTTGG - Intronic
1177624926 21:23646830-23646852 CGGCTCAGTGTGCATGCCCTTGG - Intergenic
1180758978 22:18184371-18184393 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180769265 22:18368162-18368184 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180777047 22:18494233-18494255 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180809769 22:18751571-18751593 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180827137 22:18871391-18871413 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181195907 22:21185794-21185816 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1181213621 22:21307330-21307352 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181467113 22:23116235-23116257 CAACTCACTGTGCCTCGAGTAGG - Intronic
1183235065 22:36610771-36610793 CAACTCAGCCTCCCTGACCTTGG - Intronic
1183253085 22:36744034-36744056 CACCTCAGGGTCTCTGGCCTGGG + Intergenic
1184442240 22:44524067-44524089 CAACTCAATCTCTCTGGCCTTGG - Intergenic
1185041235 22:48505467-48505489 TACCTGAGTGTGCCAGGCCTGGG + Intronic
1185159847 22:49216880-49216902 CAACTATGTGAGCCTGACCTGGG - Intergenic
1185419715 22:50728651-50728673 CAACAAAGTGGCCCTGGCCTGGG - Intergenic
1203230894 22_KI270731v1_random:109047-109069 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1203277282 22_KI270734v1_random:97296-97318 CACCCCAGTGTGCCTGGCATGGG + Intergenic
950357306 3:12422594-12422616 TAAGCCACTGTGCCTGGCCTTGG - Intronic
951570756 3:24060250-24060272 CAACTCAGTCTGACTGACCAAGG - Intergenic
951799280 3:26577098-26577120 CAAAGAAGTATGCCTGGCCTAGG + Intergenic
951992986 3:28696738-28696760 GAACTCAGTCTCCCTGGCCAGGG - Intergenic
953941625 3:47104256-47104278 TAAACCACTGTGCCTGGCCTTGG - Intronic
954083325 3:48225039-48225061 CATCTCAGTGTTGCTGGGCTGGG + Intronic
955732288 3:61999328-61999350 CAAGCCACCGTGCCTGGCCTGGG + Intronic
959499599 3:107090346-107090368 CAACACCGTGTGCCTGGCAGAGG + Intergenic
960986835 3:123286351-123286373 CCTCTCTGTGTGCCTGGGCTAGG + Intronic
961106895 3:124250041-124250063 AAACCCAGTGGGCATGGCCTGGG + Intronic
961508045 3:127384498-127384520 CACCTCAGTGTGCTTAGCCCTGG + Intergenic
961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
966257786 3:177938173-177938195 CACCTCAGTGTGCCTGATCCAGG - Intergenic
966681133 3:182643248-182643270 CAACTTCATGTGCCTGCCCTTGG + Intergenic
968585252 4:1413361-1413383 CGGCTCAGTGTGTCTGCCCTTGG - Intergenic
968683762 4:1941472-1941494 GAGCTCAGTCTCCCTGGCCTAGG + Intronic
968955509 4:3716860-3716882 CAACTCACAGGGCCTGGCCCAGG - Intergenic
969934127 4:10664648-10664670 CGACTCAGCATGCCTGGGCTGGG + Intronic
971508411 4:27392374-27392396 GAACCCACTGTACCTGGCCTTGG + Intergenic
971765007 4:30819266-30819288 CAACACAGAGAGCCAGGCCTAGG - Intronic
972190466 4:36585447-36585469 GAACTCTATGTGCCTGGCTTTGG - Intergenic
974886049 4:67818350-67818372 GAATTCAGTTTGACTGGCCTAGG + Intergenic
979825534 4:125228809-125228831 TTACTCAGTGTGTCTGGACTGGG + Intergenic
980481068 4:133387964-133387986 CATCTCAGAGTGCCTGCTCTGGG - Intergenic
981698576 4:147583474-147583496 TGAGTCACTGTGCCTGGCCTTGG - Intergenic
982272450 4:153605112-153605134 CATCTCAGGTTGCCTGGCCCTGG + Intronic
982288462 4:153758293-153758315 CAATTCAGTGGGTCTGGCGTGGG + Intronic
983522918 4:168729445-168729467 TAAGCCACTGTGCCTGGCCTGGG + Intronic
983888386 4:173006040-173006062 TCACTCAGTGTTCCTGGCTTGGG + Intronic
985491664 5:183300-183322 AAACTCACAGTGCCTGACCTCGG + Exonic
985829063 5:2214413-2214435 CGCCTCAGTGTGCTTGTCCTGGG + Intergenic
988037888 5:25851603-25851625 CAGCTCAGTGTGACAGCCCTCGG + Intergenic
990280503 5:54245869-54245891 CGAGCCACTGTGCCTGGCCTAGG + Intronic
995770319 5:115662815-115662837 CAAGCCACTGTGCCTGGCCCTGG + Intergenic
997249252 5:132376282-132376304 CAACTCTCTGGGCCTGGCTTTGG - Intronic
997354206 5:133251978-133252000 CAACTCAGAGTCCCTTGCCGTGG + Intronic
997516885 5:134496238-134496260 CATGTCAGTCTCCCTGGCCTAGG - Intergenic
998289723 5:140902319-140902341 TAACTCACTTCGCCTGGCCTAGG + Intronic
998576250 5:143320503-143320525 CTACTCAGTGTCTCTGGGCTTGG + Intronic
998775447 5:145595527-145595549 CACCTCAGTGTGCCAGGCACTGG + Intronic
999340475 5:150765869-150765891 CATCTCACTGTGCCTTACCTAGG + Intergenic
1000209613 5:159097627-159097649 CAACTGCGAGTGCCCGGCCTTGG + Intronic
1001284603 5:170413310-170413332 AAACTCATCGTGCCTGGCCTTGG + Intronic
1001311775 5:170616309-170616331 CACCTCAGTGTGCCTGGCCCAGG - Intronic
1002439621 5:179257524-179257546 CAGCTCTGTCTGCCTGGGCTGGG + Intronic
1002581853 5:180213419-180213441 CAACCCACTGAGCCTGGGCTGGG + Intergenic
1002993124 6:2256257-2256279 CCTCTCCGTGTGGCTGGCCTGGG + Intergenic
1007125344 6:39421616-39421638 CAAATCTGTCTGCTTGGCCTGGG + Intronic
1007607235 6:43125814-43125836 ACACTCAGTGTGTCTGACCTTGG - Intronic
1008105211 6:47433636-47433658 CAAGCCAATGTGACTGGCCTGGG + Intergenic
1013493461 6:110673877-110673899 TAAACCACTGTGCCTGGCCTAGG + Intronic
1015607211 6:134970414-134970436 TGACCCATTGTGCCTGGCCTGGG + Intronic
1015846791 6:137528720-137528742 CCACTCACTGTGCCTTGCCCTGG + Intergenic
1017270435 6:152497079-152497101 AAACTCAGTCTGCCTGCACTTGG + Intronic
1019645477 7:2126525-2126547 ACAATCATTGTGCCTGGCCTGGG - Intronic
1020380302 7:7537380-7537402 CCACACAGTGAGCCTGGCCCAGG + Intergenic
1022017649 7:26365805-26365827 GAACTCAGGTAGCCTGGCCTCGG - Intronic
1022659076 7:32349261-32349283 CAACTCCGTGTGCCCTGCCAGGG - Intergenic
1023017450 7:35982275-35982297 CACCTCAGTGTCCCTGGGCCTGG + Intergenic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1025908074 7:65804444-65804466 CAAGCCACTGTGCCTGGCCAAGG + Intergenic
1026601132 7:71778035-71778057 CATCTCAGTGTGTCAGGGCTCGG + Intergenic
1027444020 7:78251857-78251879 TGAGTCACTGTGCCTGGCCTAGG - Intronic
1028666970 7:93356694-93356716 CAACTCAGTGAGCTTGGTATGGG + Intronic
1028787650 7:94814062-94814084 TGAGTCACTGTGCCTGGCCTAGG + Intergenic
1029642875 7:101832218-101832240 AGACTCAGTGTGCCTGGCCCTGG + Intronic
1031016380 7:116580790-116580812 CAACTCAGTTTCCCTTGCCGGGG - Intergenic
1033907226 7:146219973-146219995 CAACTCAGTTTGCCTCTCCTGGG - Intronic
1035217821 7:157382804-157382826 CTAGTGAGTGAGCCTGGCCTGGG - Intronic
1037360471 8:18068714-18068736 CAGCTCAGGATGCCCGGCCTGGG - Intronic
1040575460 8:48647558-48647580 GAACCAAGTGTGCCTGGTCTGGG + Intergenic
1040875446 8:52146969-52146991 GGACTCAGTGTGCTTGCCCTAGG - Intronic
1041520710 8:58752867-58752889 CAGCACACTGTGCCTGGGCTAGG - Intergenic
1042082417 8:65070280-65070302 AACCACAGTGTTCCTGGCCTTGG - Intergenic
1043447247 8:80331097-80331119 CAACCCCGTGTGGCTGTCCTGGG - Intergenic
1044944159 8:97375324-97375346 TATCCCAGTGTGGCTGGCCTTGG - Intergenic
1047222134 8:122927209-122927231 TGAGTCACTGTGCCTGGCCTGGG - Intronic
1047662178 8:127049266-127049288 CAATTCAGTGAGCCTGGGTTGGG - Intergenic
1047760003 8:127947493-127947515 AGGCTCAGTGTGCCTGGCATTGG - Intergenic
1049622336 8:143604314-143604336 CAACTGAGTCAGCCTGCCCTGGG + Exonic
1050102853 9:2136596-2136618 CAACACACTGTGATTGGCCTGGG + Intronic
1051171858 9:14326384-14326406 TGACCCAGTGTGCCTGTCCTGGG - Intronic
1051960507 9:22756066-22756088 TGAATCAGTGTGTCTGGCCTGGG + Intergenic
1053145066 9:35706534-35706556 CATCTGAGTGTGCAAGGCCTGGG + Exonic
1053528576 9:38854684-38854706 CCACTCACTGTGCCAGTCCTGGG + Intergenic
1054200803 9:62079117-62079139 CCACTCACTGTGCCAGTCCTGGG + Intergenic
1054637556 9:67509246-67509268 CCACTCACTGTGCCAGTCCTGGG - Intergenic
1055106360 9:72517116-72517138 TGAGTCACTGTGCCTGGCCTAGG + Intergenic
1055662704 9:78520656-78520678 CAACTAAGTGTGCCTGTCCCTGG - Intergenic
1061212585 9:129202476-129202498 TAACTCTGTGTGTCTGTCCTTGG + Intergenic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1062012293 9:134273652-134273674 CATCTCTGTGTGCCAGGCCTGGG - Intergenic
1062429942 9:136522549-136522571 CAAGTCAGGGTGCCTGCACTGGG + Intronic
1186529510 X:10280947-10280969 CAACTCAGTGGGCCTGGGATTGG + Intergenic
1187886261 X:23891569-23891591 CAAATCAGTATCCCTAGCCTGGG + Intronic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1192367206 X:70483858-70483880 CACCTCAGTCTGCCCAGCCTAGG + Intronic
1192503635 X:71668296-71668318 CACCTCAGTGTTCCTGGGCCAGG + Intergenic
1194399295 X:93422931-93422953 CAATTCACTGTGAATGGCCTTGG + Intergenic
1197626228 X:128805080-128805102 CAACTCTGGCTTCCTGGCCTGGG + Intergenic
1197739146 X:129875989-129876011 CATCTCAGTGTGGCTGTTCTTGG - Intergenic
1198183202 X:134230101-134230123 CACCTCAATGTGCCTGGAATTGG - Intergenic
1198338674 X:135692826-135692848 CACCTCACTGAGCCTGACCTAGG - Intergenic
1199076658 X:143533581-143533603 TTCCTAAGTGTGCCTGGCCTTGG - Intergenic
1201901646 Y:19049867-19049889 CACCTCTTTGTGCCTGGCGTGGG + Intergenic