ID: 1139657361

View in Genome Browser
Species Human (GRCh38)
Location 16:68397184-68397206
Sequence ACAGGAGGCACCCATAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139657357_1139657361 -3 Left 1139657357 16:68397164-68397186 CCGATGGGGCTCTCTAATACACA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1139657353_1139657361 14 Left 1139657353 16:68397147-68397169 CCTGGTTAGCATTTTGACCGATG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1139657350_1139657361 20 Left 1139657350 16:68397141-68397163 CCCCATCCTGGTTAGCATTTTGA 0: 1
1: 0
2: 0
3: 24
4: 353
Right 1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1139657351_1139657361 19 Left 1139657351 16:68397142-68397164 CCCATCCTGGTTAGCATTTTGAC 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1139657352_1139657361 18 Left 1139657352 16:68397143-68397165 CCATCCTGGTTAGCATTTTGACC 0: 1
1: 1
2: 0
3: 6
4: 136
Right 1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139657361 Original CRISPR ACAGGAGGCACCCATAGGTA AGG Intronic
900213258 1:1467731-1467753 AGGGGAGGCACCCATGGGTCAGG - Intronic
900218484 1:1494841-1494863 AGGGGAGGCACCCATGGGTCAGG - Intronic
900772851 1:4559478-4559500 ATATGAGGGACCCATAGGGAGGG + Intergenic
905979597 1:42211568-42211590 ATAGGAGGTATCCACAGGTATGG - Intronic
906059755 1:42940859-42940881 GCAGGAGGCACCTGTATGTATGG - Intronic
906749194 1:48243322-48243344 CGAGGAGACACCCAGAGGTATGG - Intronic
914841000 1:151248649-151248671 ACAGGAGGCAGCCATGGGCTGGG + Intronic
915313559 1:155016346-155016368 ACAGGTGGCACTCATAGGGCCGG - Exonic
916212491 1:162370110-162370132 ACAGGAGGCTCCCACAGTTATGG + Exonic
918447411 1:184629203-184629225 ACAGCAGGCACCCATATGGAAGG + Intergenic
924239770 1:242029935-242029957 AAAGGAGGCACAGAGAGGTAGGG + Intergenic
924414497 1:243845260-243845282 ACAGGCAGAACCTATAGGTAAGG + Intronic
1064978072 10:21138690-21138712 ACAGGAGGCTCCGAGAGGTTTGG + Intronic
1065163503 10:22948934-22948956 ACAAGAGGCACCCAAAGGATTGG + Intronic
1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065528793 10:26648266-26648288 CCAGAAGACACCCAAAGGTAGGG + Intergenic
1065558110 10:26936731-26936753 CCAGAAGACACCCAAAGGTAGGG - Intergenic
1065558656 10:26941120-26941142 CCAGGAGACGCCCAAAGGTAGGG - Intergenic
1066295956 10:34054864-34054886 ACAAGAGGCACACATAGCCATGG - Intergenic
1073068197 10:100776620-100776642 TCAGCAGGCACACAGAGGTATGG - Intronic
1086498701 11:87430445-87430467 AAAGAGGGCACCCTTAGGTAAGG - Intergenic
1100426333 12:94490464-94490486 ACAGGAGGCAACTTTAGATAAGG - Intergenic
1101646656 12:106636785-106636807 ACAGGAGGCAGCCATTGTTTGGG + Intronic
1103916376 12:124377913-124377935 ACAGCAGGCACCCACAGGGCTGG + Intronic
1105805226 13:23948430-23948452 ACAGGAAGCTTCCATAGGCAGGG + Intergenic
1106015753 13:25867580-25867602 ACACTAGGCACCCTTAGGAAAGG - Intronic
1109097193 13:58133788-58133810 ACAGGAGACACCTTGAGGTATGG - Intergenic
1111365852 13:87244017-87244039 AAATGTGGAACCCATAGGTATGG + Intergenic
1111451625 13:88426476-88426498 ACAGGAGGCACCAAAAGGAGAGG + Intergenic
1112367328 13:98766496-98766518 ACAGAAGGCACCAAAAGGCAAGG + Intergenic
1113599053 13:111555268-111555290 ACAGGAGGCAACCATAAGAAGGG - Intergenic
1118530637 14:66701798-66701820 ACAGTAGGCAGCCATAGCTGTGG - Intronic
1121107881 14:91292965-91292987 GCAGGAGGCACCCAGAGAGAAGG - Intronic
1123434225 15:20243409-20243431 ACAGGAGGTACCCAAATGGAAGG - Intergenic
1124786689 15:32688242-32688264 ACAGGAGCCAGCCATTGGTGTGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1130133474 15:81162355-81162377 ACAGCAGGAACCCAAAAGTATGG - Intronic
1133953730 16:10421533-10421555 ACAGAAAGCAACCATACGTAGGG - Intronic
1134062094 16:11205525-11205547 ACAGGAGGCACTAAAAGGGAAGG - Intergenic
1138537490 16:57667692-57667714 ACAGGACGGACCCAGAGGCAGGG - Intergenic
1139447038 16:67004350-67004372 ACAGGAGGCTCCCAAACATAGGG - Intronic
1139657361 16:68397184-68397206 ACAGGAGGCACCCATAGGTAAGG + Intronic
1141821667 16:86450516-86450538 TCAGGAGACACCCTTAGGTGAGG - Intergenic
1142888990 17:2930696-2930718 ACAAGAGGCACCCAGAGTAAAGG - Intronic
1143849848 17:9802651-9802673 ACAGAAGGCACCGTTAGGAAAGG + Intronic
1148939439 17:51195616-51195638 ACAGCAGGCAGCTATAGCTATGG - Intronic
1149632353 17:58136992-58137014 AAAGGAGGCAGCCATAGAAAGGG - Intergenic
1153949445 18:10045740-10045762 ACAGGCGGCAGCCATGGGTGGGG - Intergenic
1160438784 18:78872726-78872748 ACAGGAGTCACCATTAGGAATGG + Intergenic
1161467144 19:4437289-4437311 ACAGGTGGGACCCAAAGGTGGGG + Intronic
1164010897 19:21202713-21202735 ACATGAGGCTACCAGAGGTAGGG - Intergenic
1165030449 19:32994527-32994549 ACTGGAGGCACCCAAATGGAAGG - Intronic
1166988700 19:46677947-46677969 AAAGGAGGCACCGGTGGGTAGGG - Intronic
927644883 2:24871400-24871422 ACAGAAGGCCCCCATAGGAGGGG - Intronic
927712446 2:25334151-25334173 CCAAGAGGCACCCATGGGTGGGG + Intronic
929097592 2:38278718-38278740 ACAAGAAGCACCCACAGGTGTGG + Intergenic
930023124 2:47013294-47013316 ACAGTTGGCACCCAGAGGTAGGG + Intronic
933691292 2:85181386-85181408 ATAGGAGGCTCCCAGAGGTACGG + Intronic
936046873 2:109195273-109195295 ACAGGAGGGTCCCATAGCTAGGG + Intronic
939813688 2:146867827-146867849 ACAGGAGGCACCCATAAGGGAGG + Intergenic
944098150 2:195993174-195993196 ACAGGAGTGACCCATTGGAAAGG - Intronic
944944750 2:204670762-204670784 ACAAAAGGCAACCATAGTTATGG - Intronic
946280802 2:218664263-218664285 AACGGAGGCACCCAAAGGGAGGG - Exonic
947744697 2:232501539-232501561 ACAGGAGGGGCCCATAAGTAGGG - Intergenic
1169227367 20:3865028-3865050 ACAGGGGGCACCCACTGGTCAGG + Intronic
1173667368 20:44772534-44772556 ACAGGAGGCACGGAGAGGTCAGG + Intronic
1177383012 21:20370116-20370138 ACAGGAGGCACACACAGAAAAGG - Intergenic
1181700992 22:24621133-24621155 ACAGGAGGACCCCATAGCTCTGG - Intronic
1181801713 22:25352018-25352040 TCAGGACTCACCCCTAGGTAGGG + Intronic
1184394005 22:44221953-44221975 ACAGATGGCACCCACAGGGAAGG - Intergenic
950093140 3:10311683-10311705 CCTGGAGGCAACCATAGCTAAGG + Intronic
952422802 3:33146385-33146407 ACAGGAGGCACCCGCTGGGAAGG + Exonic
955684440 3:61536024-61536046 CCAGGAGGCAGCCATATGGAAGG - Intergenic
961550852 3:127669867-127669889 ACAGAAGGACCCCATAGGCAAGG - Intronic
964089852 3:152862499-152862521 TCAGGAAGCACTCATAGGCAAGG + Intergenic
975556088 4:75666408-75666430 AGAGGAGGCTCCCAAAGGAATGG + Intronic
976328424 4:83799667-83799689 ACAGGAGGCACCTGTATATATGG - Intergenic
976954952 4:90884346-90884368 ACAGGAAGCACCCATGGAGAAGG + Intronic
978304324 4:107306227-107306249 AAAGGATGCACCTATATGTATGG + Intergenic
978373234 4:108050295-108050317 GGAGAAGGCACCCTTAGGTAAGG + Intronic
978373346 4:108050962-108050984 GGAGAAGGCACCCTTAGGTAAGG - Intronic
978751799 4:112257781-112257803 CCAGGAAGCAGTCATAGGTAAGG + Exonic
979524064 4:121698598-121698620 AGAGGAGGCTCCCAGAGGAAAGG - Intergenic
979591054 4:122480595-122480617 TGAGGAGGAACCCTTAGGTAGGG + Intergenic
982864547 4:160493591-160493613 ACAGGAGGAACCCTTAGTTCTGG + Intergenic
985236487 4:187880917-187880939 ACAGGTGCCACCCACAGCTATGG + Intergenic
985434648 4:189917086-189917108 CCAGAAGACACCCAAAGGTAAGG - Intergenic
986877888 5:12132790-12132812 ACAGGAGGCAGGAATGGGTAGGG - Intergenic
987070753 5:14334923-14334945 ACAGGTGGCAGCCATAGGAGGGG + Intronic
988810948 5:34784938-34784960 ACAGAAAGTAGCCATAGGTAGGG - Intronic
993321928 5:86481172-86481194 AACGGAGGCACCTACAGGTAAGG - Intergenic
996001438 5:118369024-118369046 ACAGGAGGTAGCTAGAGGTAAGG - Intergenic
1003039200 6:2671275-2671297 ACAGGAGGCAGCCATTTGGAAGG - Exonic
1003654044 6:7988981-7989003 ACATGAGGCAGCCATGGGTTGGG + Intronic
1007696004 6:43734550-43734572 AAAGGAGGCACCCAGAGCTCTGG - Intergenic
1007710980 6:43824143-43824165 ACAGCAGGCACACACAGGCATGG - Intergenic
1008089167 6:47275959-47275981 ACAGTAGGCACACTCAGGTAAGG + Intronic
1008233850 6:49019310-49019332 ACAGAGGGCACCCACAGCTATGG - Intergenic
1010647466 6:78408464-78408486 TCAGGAGGCACTCACAGGAATGG - Intergenic
1010684030 6:78831033-78831055 ACAGAAGGCACACATGGGTGTGG + Intergenic
1010794980 6:80107756-80107778 AGAGGAGGAAGCCATAGGAAGGG + Intronic
1013516652 6:110893265-110893287 ACAGGAGGAACCCATCAGTTTGG - Intronic
1016575851 6:145568996-145569018 GGAGGAGGCAGCCATAGGCATGG + Intronic
1017151346 6:151283186-151283208 ACAAGAGGCACTCAAAGGCAGGG + Intronic
1017405465 6:154114137-154114159 ACAAGAGGCATGCATAGATAAGG + Intronic
1019877426 7:3826653-3826675 ACAGGATGCCCTCATAGGCATGG - Intronic
1021048092 7:15948117-15948139 ACAGCACACACCCATAGCTAGGG - Intergenic
1022782727 7:33602418-33602440 ACAGGAGGCATCCAAAGAAAGGG + Intronic
1026249743 7:68659183-68659205 ACAAGAGGCACCCATTGGCCAGG + Intergenic
1028489785 7:91398556-91398578 ACAGGAGCCACAGATAGGCATGG + Intergenic
1034579665 7:152031630-152031652 ACTGGTGGCACACCTAGGTAAGG - Intronic
1038940566 8:32299836-32299858 ACAGGAGGGACCCAGTGGAAGGG - Intronic
1047226086 8:122956444-122956466 AGAGGAGGAACACCTAGGTAGGG + Intronic
1055360213 9:75481578-75481600 ACAGGAAGCAGCCAGAGGGAGGG + Intergenic
1058200466 9:102032967-102032989 ACCATAGGCAGCCATAGGTAGGG - Intergenic
1058240045 9:102546983-102547005 TTAGGATGCTCCCATAGGTATGG - Intergenic
1059040396 9:110808470-110808492 ACAGGAAAGACCCATAGGTGTGG + Intergenic
1061676860 9:132222316-132222338 ACAGCAGGCACCTATTGGTACGG - Intronic
1187546671 X:20261077-20261099 ACACGTGGGACTCATAGGTAGGG + Intronic
1192204797 X:69088727-69088749 AGAGGAGCCACCTATAGGAATGG + Intergenic
1194851923 X:98880970-98880992 ACAGCAGGCAGCCATAGCTGTGG - Intergenic
1194895086 X:99430631-99430653 ACAGCAGACACCCACAGGTTTGG + Intergenic
1197861900 X:130979805-130979827 ACAGGAGAGATCCAGAGGTAAGG + Intergenic
1198251688 X:134885083-134885105 ACAGGAGGCACGGTTAGGAATGG - Intergenic
1200835633 Y:7728675-7728697 ACAGAAGACACCCAGAGGTTAGG - Intergenic
1202019292 Y:20448535-20448557 ACAGCAGGAAGGCATAGGTAAGG + Intergenic