ID: 1139661355

View in Genome Browser
Species Human (GRCh38)
Location 16:68423169-68423191
Sequence CCTCCTTGTCACCTCCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139661353_1139661355 -9 Left 1139661353 16:68423155-68423177 CCAAGGTTTTCTGGCCTCCTTGT 0: 1
1: 0
2: 1
3: 18
4: 262
Right 1139661355 16:68423169-68423191 CCTCCTTGTCACCTCCTTTATGG 0: 1
1: 0
2: 3
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139661355 Original CRISPR CCTCCTTGTCACCTCCTTTA TGG Intronic
900347794 1:2218717-2218739 CCTCCTTTGCTCCTCCATTACGG + Intergenic
900774857 1:4575144-4575166 GCTCCTTCTCACCTCCTTTGAGG - Intergenic
903776064 1:25794620-25794642 CCTCCTTGACACCTCCGTGAGGG + Intergenic
904374495 1:30071632-30071654 CCTCCTTCTGCCCTCCTTTCAGG + Intergenic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
908337642 1:63143929-63143951 CCTCTTTGTCACATCATTAAAGG + Intergenic
908583076 1:65538328-65538350 CCTCCTTGCCATCTCCTTTTGGG + Intronic
909092718 1:71246637-71246659 CTTCCTTGTTTTCTCCTTTATGG + Intergenic
909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG + Intronic
909750957 1:79159934-79159956 CCTCCTTGTCTCATCCTCTAAGG - Intergenic
909773161 1:79451485-79451507 CAACCTTGTCACATCCTTTTGGG - Intergenic
910677432 1:89828683-89828705 ACCCCTTGACACCTCCTTTTGGG + Intronic
914262962 1:146014908-146014930 CCTCCTCTCCACCTCTTTTAAGG + Intergenic
914418006 1:147502394-147502416 ACTCCTTGCTACCTCCTTTTAGG - Intergenic
914513282 1:148352961-148352983 CCTCCTTCTCTGCTCCTTTTTGG - Intergenic
915570719 1:156743824-156743846 CCTCCTTCTCCTCTCCTTCAGGG + Exonic
918276381 1:182957068-182957090 CCTCCTTCTCTCCTCCTTTTTGG - Intergenic
919100510 1:193091439-193091461 GCTCCCTGTCCCCTCCTTTCAGG - Intronic
922552391 1:226505520-226505542 ATTCCCTGTCACCACCTTTAGGG + Intergenic
923224507 1:231926845-231926867 TCCCTTTGTGACCTCCTTTAAGG + Intronic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1063377217 10:5561542-5561564 CCTCCTTGGCACCTGCTCCAGGG - Intergenic
1067232442 10:44421554-44421576 CCTGCCTGTCACCTCCTTCCAGG + Intergenic
1069834990 10:71302623-71302645 GCTCCTGGTCACCTCCCCTAAGG - Exonic
1069903170 10:71717414-71717436 CCCCCTTGTCAACTCCTTGTGGG - Intronic
1073599919 10:104836568-104836590 CCTTATTGTCACCTTATTTATGG + Intronic
1074284719 10:112087508-112087530 CCCCCTTGTCTCATCCTTAATGG + Intergenic
1074840560 10:117346735-117346757 TTTCCTTGTCACCACTTTTAGGG + Intronic
1076047774 10:127308286-127308308 CCTCCTTGCCACCTCGTTGGTGG + Intronic
1076424195 10:130355810-130355832 CCTCCAAATCATCTCCTTTAAGG - Intergenic
1076453829 10:130575664-130575686 CCTCCTTGACACGTCCTCTTTGG + Intergenic
1078867180 11:15308616-15308638 GCTCCATATCACCTCCTTTCTGG - Intergenic
1078956275 11:16198945-16198967 CCTACGTGTCAGCTCCTTAAGGG + Intronic
1081011411 11:37817412-37817434 TCTCCTCTTCACCTCCTTTGTGG - Intergenic
1082168700 11:48975525-48975547 GCTCCTTCTCACCTCCTCTCTGG - Intergenic
1082234723 11:49810192-49810214 GCTCCTTCTCACCTCCTCTCAGG + Intergenic
1082237187 11:49833164-49833186 GCTCCTTCTCACCTCCTCTCAGG - Intergenic
1082238081 11:49843986-49844008 GCTCCTTCTCACCTCCTCTCAGG - Intergenic
1082610572 11:55292090-55292112 GCTCCTTCTCACCTCCTCTCAGG - Intergenic
1082658547 11:55881197-55881219 GCTCCTTCTCACCTCCTCTCAGG + Intergenic
1082659370 11:55891583-55891605 GCTCCTTCTCACCTCCTCTCAGG + Exonic
1084131654 11:67140449-67140471 CCTACTTGTAACTTCTTTTAAGG - Intronic
1084958733 11:72704867-72704889 CCTCCTTGTCAGGTCCTGTATGG + Intronic
1085391676 11:76185358-76185380 CTTCCGTGTCACCTCCCTCATGG - Intergenic
1086258566 11:84909969-84909991 CCTCATTATCCCCTCCTTCAGGG - Intronic
1086696343 11:89850743-89850765 GCTCCTTCTCACCTCCTCTCAGG + Intergenic
1086697528 11:89862844-89862866 GCTCCTTCTCACCTCCTCTCAGG + Intergenic
1086702180 11:89911614-89911636 GCTCCTTCTCACCTCCTCTCAGG - Exonic
1086703987 11:89932836-89932858 GCTCCTTCTCACCTCCTCTCAGG + Intergenic
1086708630 11:89981644-89981666 GCTCCTTCTCACCTCCTCTCAGG - Intergenic
1086709815 11:89993746-89993768 GCTCCTTCTCACCTCCTCTCAGG - Intergenic
1088880402 11:113969202-113969224 CTTCCCTTTCACCTCCTTTCTGG - Intergenic
1089389569 11:118091327-118091349 CCTTCTTGTCACCTCCTCTAGGG + Intronic
1091485958 12:888621-888643 CCTCCTTGCCACCATCTGTAGGG + Intronic
1091885653 12:4015387-4015409 CCTCTTTGTCACCTCTGCTACGG - Intergenic
1093159002 12:15722782-15722804 GTTCCTTCTCACCTCTTTTAAGG + Intronic
1095899419 12:47312451-47312473 CCGCCTTATAACCTCCTTAAGGG + Intergenic
1096675398 12:53223162-53223184 CCTCCTTGCCACCTTCTGGATGG + Intronic
1096916167 12:55035856-55035878 CCTCCTTGTGATCTTCTCTAAGG - Intergenic
1098587931 12:72176421-72176443 TCTAGCTGTCACCTCCTTTAGGG - Intronic
1098820838 12:75226879-75226901 CCTATTTGTTTCCTCCTTTAGGG - Intergenic
1100374123 12:93996518-93996540 CCTACTTGTAAGCTCCTTTAGGG + Intergenic
1102218895 12:111180874-111180896 CCTCCCGGGCTCCTCCTTTATGG + Intronic
1103513930 12:121494517-121494539 CCTCCTTCCCACCTCCTGTAGGG - Intronic
1103915788 12:124374927-124374949 CCTGCTTCTCACCTCCCTTCAGG + Intronic
1105773617 13:23636448-23636470 TCTCCTCGTCTTCTCCTTTAGGG + Intronic
1107130202 13:36886757-36886779 TCTCATTGTCACCTCCTCAAGGG - Intronic
1108368607 13:49744362-49744384 ATTCCCTGTCAACTCCTTTATGG - Intronic
1108646095 13:52430185-52430207 CCTCTTTTTCACCTCTTTGAAGG - Intronic
1109420571 13:62106116-62106138 CCTTCTTGTCACCTGCTTCGTGG - Intergenic
1109525307 13:63566989-63567011 CCTTCTTGTCACCTACATTGTGG - Intergenic
1112981788 13:105393826-105393848 CCTCCCTGTCACCTCCCATTGGG - Intergenic
1113309550 13:109117629-109117651 CCACCTTTCCACTTCCTTTAGGG - Intronic
1113747859 13:112757625-112757647 CCTCCTTGTCTCATCCCTCAAGG + Intronic
1117791067 14:59342851-59342873 CCTCCTTGACACCACCTTCCCGG - Intronic
1118456313 14:65948281-65948303 CCTCAAGGTCACCTCCTTCAGGG - Intergenic
1120463057 14:84821451-84821473 CCTCATGGTCAGCTCCTTGAGGG + Intergenic
1121311073 14:92935367-92935389 CCTCCTGGGGACCTCCTTTCTGG + Intergenic
1121445002 14:93973155-93973177 CCTGGTTGTCACCTCCTACAGGG - Intronic
1121548097 14:94777483-94777505 CTTCCTTCTCACCTCCTTTCTGG + Intergenic
1122312134 14:100804109-100804131 TCTCCTTGACACCTCCCTCAGGG + Intergenic
1124186051 15:27530576-27530598 CCTCCATTTCACTTCATTTAGGG - Intronic
1126064745 15:44818059-44818081 AGTCCTTGACACCTCCTTTTAGG - Intergenic
1126095092 15:45082534-45082556 AGTCCTTGACACCTCCTTTTAGG + Intergenic
1126412868 15:48389804-48389826 CCTCCTTGTCCCAACCTTTCAGG - Intergenic
1126722827 15:51600267-51600289 CCTGGTTATCACCTCCTTTTAGG + Intronic
1126868585 15:52963034-52963056 CCTCCCTGTCACTTTCTTTCGGG + Intergenic
1129773351 15:78216884-78216906 GCTGCTTGCCAACTCCTTTAGGG - Intronic
1129877356 15:78984340-78984362 CCTCATTGTCCTCTCCTATAAGG + Intronic
1130073721 15:80670873-80670895 CCTCCTTGTCTCCTCACTTGTGG - Intergenic
1132829967 16:1923206-1923228 CCTCCTTGTCACCTCTCCAAGGG - Intergenic
1133779736 16:8928736-8928758 CCTTCTTGTGACCTCCTTGATGG - Intronic
1135053472 16:19211467-19211489 CCACCTTGTCATTTCCTTCACGG - Intronic
1135424178 16:22324161-22324183 CCTCCTTTTCTCCTCCATAAAGG - Intronic
1136233771 16:28902677-28902699 CCTCCTGGTCCCCTCCTTTGTGG - Intronic
1139661355 16:68423169-68423191 CCTCCTTGTCACCTCCTTTATGG + Intronic
1140031927 16:71345729-71345751 CCTCCTGGCCACCTCCTTGGGGG + Intergenic
1141525175 16:84606581-84606603 ACTCCTTGTCACCTTCTCCAAGG + Intronic
1141722380 16:85763583-85763605 CCTCCTGGGCACCTCCTGTGGGG + Intergenic
1144612861 17:16739404-16739426 CCTCCTTTTCACTTTCTTGATGG + Intronic
1144899924 17:18576183-18576205 CCTCCTTTTCACTTTCTTGATGG - Intergenic
1145132520 17:20369482-20369504 CCTCCTTTTCACTTTCTTGATGG + Intergenic
1145732920 17:27206201-27206223 CCTCCCTGTCCCCTCTTATAAGG + Intergenic
1151548411 17:74807295-74807317 CCTCATTGTGAGCTCCTTCAGGG + Intronic
1152400099 17:80061041-80061063 CCTCCTAGTCTTTTCCTTTAAGG - Intronic
1154059086 18:11042104-11042126 CCTTCTAGTCATCTCCTCTAAGG + Intronic
1155196450 18:23479322-23479344 CTTCCTTGACTCCTCCTTTCTGG - Exonic
1155954496 18:31945811-31945833 CCTCAGTATCATCTCCTTTAAGG - Intronic
1158514977 18:58123416-58123438 CCACCTTTTCACCCCCTTTCCGG + Intronic
1158707018 18:59801824-59801846 CCTACTTTTCCCCTCTTTTAAGG + Intergenic
1161281589 19:3448660-3448682 CCTCCCTGCCACCTTCTCTAGGG + Intronic
1161904559 19:7146541-7146563 CCTCTTTGTCAAGTTCTTTAAGG + Intronic
1163810688 19:19429619-19429641 CCTGCCTGTCTCCTCCTTCAAGG + Intronic
1167360954 19:49030109-49030131 CTTCTTTGTCACCTGCTTCAAGG + Intronic
932200050 2:69818224-69818246 CCTCCCTGTCATCTCCCTTTTGG - Intronic
943013978 2:182489121-182489143 GCACCCTCTCACCTCCTTTAGGG - Intronic
1170391626 20:15881056-15881078 CCACTTTGTGACCTCCTTGAGGG + Intronic
1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG + Intronic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1174507342 20:51024937-51024959 CCTCCTTCTCTCCTGCTTGAAGG - Intergenic
1176993055 21:15521693-15521715 CCTTCTTGTCACCTGCAATATGG + Intergenic
1179975244 21:44861716-44861738 CCTCCTCCTCACCTCCTGTGAGG + Intronic
1180859500 22:19069223-19069245 CCTCCCTGTGACCTCCCTTGGGG - Intronic
1180918903 22:19508317-19508339 CCTTCTTGTCAACAGCTTTATGG - Intronic
1182010714 22:26998642-26998664 GCTCCTTGTCAGCTCGTTTTTGG - Intergenic
1183384591 22:37507760-37507782 GCTCCTTGTCTCCTCCCATATGG + Intronic
1184710194 22:46245238-46245260 CATCCTTGTCCACTTCTTTAAGG - Exonic
952885937 3:38010981-38011003 CCCTCTTGGCACCTCCTTCAGGG - Intronic
955733573 3:62013026-62013048 CTTCCTTTTTACCTCTTTTAAGG - Intronic
959283935 3:104382629-104382651 CCCCCTTCTCATCTCCTTTTGGG - Intergenic
960482552 3:118211486-118211508 CTTCCTTCCCACCTCCTTTTGGG - Intergenic
961672825 3:128547413-128547435 CATCCATGTCACCACCTTTTGGG - Intergenic
964173070 3:153793789-153793811 CTTCCTTTTCACCTTCTGTAAGG + Intergenic
969922879 4:10557371-10557393 CCTCCCTGTGACCTCCTGTTGGG - Intronic
970293465 4:14602208-14602230 CCTGATTATCACCTTCTTTAAGG - Intergenic
974169271 4:58245371-58245393 CCTCCTTGTCTCCTTGTTTGTGG - Intergenic
974664462 4:64939716-64939738 CATTCTTGTTACCTCCTATAAGG - Intergenic
976145887 4:82042797-82042819 CCTCCTTATCACCTACTATTGGG + Intronic
976972281 4:91119012-91119034 ACTCCTTCACACCTCTTTTAAGG - Intronic
978224745 4:106320675-106320697 CTTCCTTGTCACCTCCTTTCAGG - Intronic
978399357 4:108314450-108314472 CCTTCTTGTTACCTGCTTTCTGG + Intergenic
978611604 4:110546756-110546778 CCATCTTCTCACTTCCTTTAAGG - Intronic
978987292 4:115028976-115028998 CCTCCTTGTCACCTTAGTTTTGG - Intronic
979230745 4:118346636-118346658 CCTCCTGGTCACCTCCTGCTGGG - Intronic
982611120 4:157575253-157575275 CCTTCTTGTCACCTACAATATGG - Intergenic
986635244 5:9815125-9815147 CCTCCTTTTCTACTCCTTTAAGG - Intergenic
986892295 5:12323798-12323820 TTTCCTTGTCACCCCTTTTATGG + Intergenic
987403122 5:17498389-17498411 CCTCATTGTCACCTTCTGTGAGG - Intergenic
987959644 5:24789429-24789451 CCTCTATTTCACCTCCTTTCTGG - Intergenic
988342083 5:29985604-29985626 CATCCTTGACACCTGCTTTCAGG + Intergenic
988513124 5:31882448-31882470 CCTCCCTCTCCCCTTCTTTATGG - Intronic
989505217 5:42218790-42218812 CCTCCTTGTCAACTGCTTGTTGG - Intergenic
998716207 5:144888093-144888115 GTTCCTTACCACCTCCTTTAGGG - Intergenic
1002854716 6:1026701-1026723 CATCTTTGCCACCTCCTTTCTGG + Intergenic
1003039097 6:2670573-2670595 CCTCTTAGTCTTCTCCTTTAGGG + Intronic
1005443869 6:25900840-25900862 CCTTCTTGTCACATCATTTTAGG - Intergenic
1007088499 6:39167383-39167405 GCTCCTGGACACCTCCTTCAAGG + Intergenic
1009216170 6:60922527-60922549 CATCATTCTAACCTCCTTTAAGG + Intergenic
1015038875 6:128692013-128692035 CCTTCTTGTGACTTCCTTCAGGG + Intergenic
1019340296 7:505750-505772 ACTCCTTCTCACCTCTTTCACGG + Intronic
1020539659 7:9444490-9444512 CCTCCTTATCTTCTCATTTAAGG + Intergenic
1022242798 7:28529298-28529320 CCACCTTGGCACCTCCTTCGGGG - Intronic
1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG + Intergenic
1026309307 7:69170054-69170076 CCTCATTGTCACCATCGTTATGG - Intergenic
1027681884 7:81232578-81232600 CCTCCTTGTCACCTGCAGCAGGG + Intergenic
1028198898 7:87937603-87937625 CCTCCTTTTCTCCCCATTTATGG + Intronic
1031408863 7:121419353-121419375 CCTCCTAATCACCTCCATCATGG + Intergenic
1032936513 7:136739157-136739179 CCTCCTTGCCTCCTTCTTAATGG - Intergenic
1033240959 7:139679742-139679764 CCTCCTTGTCAGCTCATCTCAGG + Intronic
1033810607 7:145006625-145006647 GCTCCTGGTCACTCCCTTTATGG + Intergenic
1034944276 7:155251873-155251895 CCTCCTGGTCCCCTCCCTGATGG + Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1039343849 8:36682234-36682256 CATCTTTGTCACCTCTTTAAAGG + Intergenic
1040101672 8:43511841-43511863 CCTCCTTGCCTCCACCTGTAGGG + Intergenic
1042011642 8:64252483-64252505 CCTCCCTGTCATCTCCCTCAAGG - Intergenic
1043534257 8:81184305-81184327 ACTCCTAGTCCCCTACTTTAGGG + Intergenic
1045151209 8:99410458-99410480 ACTCCATGTTACCTCCTTTGTGG + Intronic
1048233017 8:132662417-132662439 CCTCCTTGTCATTACCTTTTTGG - Intronic
1048493012 8:134912067-134912089 TCTCCTTGTCAAGTACTTTAGGG - Intergenic
1050002004 9:1086984-1087006 CCTCATTTTTAACTCCTTTAAGG + Intergenic
1050983274 9:12048323-12048345 CCTCCATTTAACCTCCTTTCTGG - Intergenic
1051875308 9:21786903-21786925 CTTCTTTGGCAGCTCCTTTAAGG - Intergenic
1052316662 9:27122713-27122735 CTTCCTTGGCACATCCTTTCAGG - Intronic
1055211210 9:73795507-73795529 CCTACTTGACACCTCCATTTGGG + Intergenic
1056979574 9:91296761-91296783 CCTCCTTTTCACTTCATTTTAGG - Intronic
1059452663 9:114380417-114380439 CTTCCTTGTAACCTGCTTTTTGG - Intronic
1059826203 9:118031747-118031769 CCTCTTTATCACCTCCTTCAAGG - Intergenic
1060995692 9:127873943-127873965 CCTTCTTGACAGCTCCTGTAGGG - Intronic
1186676816 X:11826417-11826439 CCTCCTATCCTCCTCCTTTAGGG - Intergenic
1187118947 X:16384531-16384553 CCTCCCTCTCTCCTCCTTTTTGG + Intergenic
1189536260 X:41938395-41938417 CCTCCTTGCCAACTCATTTGAGG - Intergenic
1191721453 X:64231883-64231905 CCTCCATGTCACCTTGTTTCAGG + Intergenic
1192763437 X:74119606-74119628 ACTCCTAGCCACCTCCATTAGGG + Intergenic
1195200925 X:102549591-102549613 CTTTCTTGTCACCTCATTTTTGG - Intergenic
1195290297 X:103425741-103425763 CCTTCTTGTCACTTCATTTCTGG + Intergenic
1195450507 X:105006840-105006862 ACTCCTTGTTAGATCCTTTAAGG + Intronic
1196025000 X:111032843-111032865 CCTCCTTGTCCTCTTCTTAAAGG + Intronic
1197942275 X:131802764-131802786 CCTCCTTGCCTTCTCCTCTAAGG - Intergenic
1198438242 X:136637505-136637527 CATCCTTGCCACCACTTTTAGGG + Intergenic
1199069230 X:143457222-143457244 CCTCCTAGTGCCCTTCTTTAGGG - Intergenic
1200276024 X:154733596-154733618 AATCCTTCTCTCCTCCTTTATGG + Intronic