ID: 1139666492

View in Genome Browser
Species Human (GRCh38)
Location 16:68460541-68460563
Sequence ATGGATGCCCAGAGGGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139666485_1139666492 -2 Left 1139666485 16:68460520-68460542 CCCCATTTTACAGCCAAGGAAAT No data
Right 1139666492 16:68460541-68460563 ATGGATGCCCAGAGGGTTACAGG No data
1139666486_1139666492 -3 Left 1139666486 16:68460521-68460543 CCCATTTTACAGCCAAGGAAATG No data
Right 1139666492 16:68460541-68460563 ATGGATGCCCAGAGGGTTACAGG No data
1139666487_1139666492 -4 Left 1139666487 16:68460522-68460544 CCATTTTACAGCCAAGGAAATGG No data
Right 1139666492 16:68460541-68460563 ATGGATGCCCAGAGGGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139666492 Original CRISPR ATGGATGCCCAGAGGGTTAC AGG Intergenic
No off target data available for this crispr