ID: 1139667676

View in Genome Browser
Species Human (GRCh38)
Location 16:68469234-68469256
Sequence CCCTCGCTTTTGTCATAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139667665_1139667676 24 Left 1139667665 16:68469187-68469209 CCCTGTGCAGCTGCCTGATTCAC No data
Right 1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG No data
1139667669_1139667676 -7 Left 1139667669 16:68469218-68469240 CCCAGTGCCCAAGACCCCCTCGC No data
Right 1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG No data
1139667667_1139667676 11 Left 1139667667 16:68469200-68469222 CCTGATTCACTCCTCAGACCCAG No data
Right 1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG No data
1139667666_1139667676 23 Left 1139667666 16:68469188-68469210 CCTGTGCAGCTGCCTGATTCACT No data
Right 1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG No data
1139667670_1139667676 -8 Left 1139667670 16:68469219-68469241 CCAGTGCCCAAGACCCCCTCGCT No data
Right 1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG No data
1139667668_1139667676 0 Left 1139667668 16:68469211-68469233 CCTCAGACCCAGTGCCCAAGACC No data
Right 1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139667676 Original CRISPR CCCTCGCTTTTGTCATAGCC TGG Intergenic