ID: 1139671085

View in Genome Browser
Species Human (GRCh38)
Location 16:68492884-68492906
Sequence CAACCCAGGTGGAGCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139671074_1139671085 28 Left 1139671074 16:68492833-68492855 CCAGAGGGTCAGGCTGGGGATCC No data
Right 1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG No data
1139671078_1139671085 0 Left 1139671078 16:68492861-68492883 CCTGGAGTACAGAGTCCTGCCAG No data
Right 1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG No data
1139671076_1139671085 7 Left 1139671076 16:68492854-68492876 CCCTGAACCTGGAGTACAGAGTC No data
Right 1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG No data
1139671077_1139671085 6 Left 1139671077 16:68492855-68492877 CCTGAACCTGGAGTACAGAGTCC No data
Right 1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139671085 Original CRISPR CAACCCAGGTGGAGCCAGTG GGG Intergenic
No off target data available for this crispr