ID: 1139671257

View in Genome Browser
Species Human (GRCh38)
Location 16:68493520-68493542
Sequence CAACTACCTGCAGCCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139671244_1139671257 21 Left 1139671244 16:68493476-68493498 CCTGAGTGTGGCCCTCTCTGGAT No data
Right 1139671257 16:68493520-68493542 CAACTACCTGCAGCCTCCCTTGG No data
1139671249_1139671257 10 Left 1139671249 16:68493487-68493509 CCCTCTCTGGATGGTGGGGTGAA No data
Right 1139671257 16:68493520-68493542 CAACTACCTGCAGCCTCCCTTGG No data
1139671250_1139671257 9 Left 1139671250 16:68493488-68493510 CCTCTCTGGATGGTGGGGTGAAG No data
Right 1139671257 16:68493520-68493542 CAACTACCTGCAGCCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139671257 Original CRISPR CAACTACCTGCAGCCTCCCT TGG Intergenic
No off target data available for this crispr