ID: 1139672007

View in Genome Browser
Species Human (GRCh38)
Location 16:68498516-68498538
Sequence CTGTTGATGGCAAGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139672001_1139672007 -7 Left 1139672001 16:68498500-68498522 CCATCCTCAGGGGCCCCTGTTGA No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data
1139671997_1139672007 9 Left 1139671997 16:68498484-68498506 CCAGGAGCATCTCACGCCATCCT No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data
1139671995_1139672007 13 Left 1139671995 16:68498480-68498502 CCACCCAGGAGCATCTCACGCCA No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data
1139671994_1139672007 14 Left 1139671994 16:68498479-68498501 CCCACCCAGGAGCATCTCACGCC No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data
1139671992_1139672007 25 Left 1139671992 16:68498468-68498490 CCTGTAAGCCACCCACCCAGGAG No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data
1139671996_1139672007 10 Left 1139671996 16:68498483-68498505 CCCAGGAGCATCTCACGCCATCC No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data
1139671993_1139672007 17 Left 1139671993 16:68498476-68498498 CCACCCACCCAGGAGCATCTCAC No data
Right 1139672007 16:68498516-68498538 CTGTTGATGGCAAGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139672007 Original CRISPR CTGTTGATGGCAAGAGTGTC TGG Intergenic
No off target data available for this crispr