ID: 1139672814

View in Genome Browser
Species Human (GRCh38)
Location 16:68503285-68503307
Sequence CTCTGGAAATGAGTGTTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139672810_1139672814 6 Left 1139672810 16:68503256-68503278 CCTTGTGTTTTCATAAGGTTAGG No data
Right 1139672814 16:68503285-68503307 CTCTGGAAATGAGTGTTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139672814 Original CRISPR CTCTGGAAATGAGTGTTCCG TGG Intergenic
No off target data available for this crispr