ID: 1139674378

View in Genome Browser
Species Human (GRCh38)
Location 16:68513025-68513047
Sequence TTGGACTGGCTTAGCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139674378_1139674386 25 Left 1139674378 16:68513025-68513047 CCAGGAGAGCTAAGCCAGTCCAA No data
Right 1139674386 16:68513073-68513095 GCCTTATGGTGGCTAGTTTGGGG No data
1139674378_1139674384 23 Left 1139674378 16:68513025-68513047 CCAGGAGAGCTAAGCCAGTCCAA No data
Right 1139674384 16:68513071-68513093 TTGCCTTATGGTGGCTAGTTTGG No data
1139674378_1139674382 14 Left 1139674378 16:68513025-68513047 CCAGGAGAGCTAAGCCAGTCCAA No data
Right 1139674382 16:68513062-68513084 ATCACCATCTTGCCTTATGGTGG No data
1139674378_1139674385 24 Left 1139674378 16:68513025-68513047 CCAGGAGAGCTAAGCCAGTCCAA No data
Right 1139674385 16:68513072-68513094 TGCCTTATGGTGGCTAGTTTGGG No data
1139674378_1139674381 11 Left 1139674378 16:68513025-68513047 CCAGGAGAGCTAAGCCAGTCCAA No data
Right 1139674381 16:68513059-68513081 TAAATCACCATCTTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139674378 Original CRISPR TTGGACTGGCTTAGCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr