ID: 1139675533

View in Genome Browser
Species Human (GRCh38)
Location 16:68520663-68520685
Sequence GCTTCTCTCTACCCTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139675533_1139675538 20 Left 1139675533 16:68520663-68520685 CCAGGCTCAGGGTAGAGAGAAGC No data
Right 1139675538 16:68520706-68520728 GAGCCGCCCCCTCTCTGGACAGG No data
1139675533_1139675535 -8 Left 1139675533 16:68520663-68520685 CCAGGCTCAGGGTAGAGAGAAGC No data
Right 1139675535 16:68520678-68520700 AGAGAAGCAATACAGAGGCCAGG No data
1139675533_1139675539 21 Left 1139675533 16:68520663-68520685 CCAGGCTCAGGGTAGAGAGAAGC No data
Right 1139675539 16:68520707-68520729 AGCCGCCCCCTCTCTGGACAGGG No data
1139675533_1139675544 28 Left 1139675533 16:68520663-68520685 CCAGGCTCAGGGTAGAGAGAAGC No data
Right 1139675544 16:68520714-68520736 CCCTCTCTGGACAGGGCTGCAGG No data
1139675533_1139675537 15 Left 1139675533 16:68520663-68520685 CCAGGCTCAGGGTAGAGAGAAGC No data
Right 1139675537 16:68520701-68520723 TAAGAGAGCCGCCCCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139675533 Original CRISPR GCTTCTCTCTACCCTGAGCC TGG (reversed) Intergenic
No off target data available for this crispr