ID: 1139675919

View in Genome Browser
Species Human (GRCh38)
Location 16:68523496-68523518
Sequence CAATGACCCTGGGATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139675919_1139675925 -5 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675925 16:68523514-68523536 CATTGAATATCCTCGTCTCGGGG No data
1139675919_1139675926 -4 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675926 16:68523515-68523537 ATTGAATATCCTCGTCTCGGGGG No data
1139675919_1139675927 4 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675927 16:68523523-68523545 TCCTCGTCTCGGGGGCACAGAGG No data
1139675919_1139675924 -6 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675924 16:68523513-68523535 TCATTGAATATCCTCGTCTCGGG No data
1139675919_1139675930 12 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675919_1139675923 -7 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675923 16:68523512-68523534 GTCATTGAATATCCTCGTCTCGG No data
1139675919_1139675933 28 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675933 16:68523547-68523569 ATCTGGGGAAAGCCTTGCCTGGG No data
1139675919_1139675929 11 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675929 16:68523530-68523552 CTCGGGGGCACAGAGGTATCTGG No data
1139675919_1139675932 27 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675932 16:68523546-68523568 TATCTGGGGAAAGCCTTGCCTGG No data
1139675919_1139675931 13 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675931 16:68523532-68523554 CGGGGGCACAGAGGTATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139675919 Original CRISPR CAATGACCCTGGGATGTGGC TGG (reversed) Intergenic
No off target data available for this crispr