ID: 1139675920

View in Genome Browser
Species Human (GRCh38)
Location 16:68523500-68523522
Sequence TATTCAATGACCCTGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139675920_1139675931 9 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675931 16:68523532-68523554 CGGGGGCACAGAGGTATCTGGGG No data
1139675920_1139675925 -9 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675925 16:68523514-68523536 CATTGAATATCCTCGTCTCGGGG No data
1139675920_1139675932 23 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675932 16:68523546-68523568 TATCTGGGGAAAGCCTTGCCTGG No data
1139675920_1139675934 27 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675934 16:68523550-68523572 TGGGGAAAGCCTTGCCTGGGTGG No data
1139675920_1139675933 24 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675933 16:68523547-68523569 ATCTGGGGAAAGCCTTGCCTGGG No data
1139675920_1139675929 7 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675929 16:68523530-68523552 CTCGGGGGCACAGAGGTATCTGG No data
1139675920_1139675930 8 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675920_1139675926 -8 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675926 16:68523515-68523537 ATTGAATATCCTCGTCTCGGGGG No data
1139675920_1139675924 -10 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675924 16:68523513-68523535 TCATTGAATATCCTCGTCTCGGG No data
1139675920_1139675927 0 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675927 16:68523523-68523545 TCCTCGTCTCGGGGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139675920 Original CRISPR TATTCAATGACCCTGGGATG TGG (reversed) Intergenic
No off target data available for this crispr