ID: 1139675921

View in Genome Browser
Species Human (GRCh38)
Location 16:68523506-68523528
Sequence CGAGGATATTCAATGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139675921_1139675934 21 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675934 16:68523550-68523572 TGGGGAAAGCCTTGCCTGGGTGG No data
1139675921_1139675931 3 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675931 16:68523532-68523554 CGGGGGCACAGAGGTATCTGGGG No data
1139675921_1139675927 -6 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675927 16:68523523-68523545 TCCTCGTCTCGGGGGCACAGAGG No data
1139675921_1139675930 2 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675921_1139675933 18 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675933 16:68523547-68523569 ATCTGGGGAAAGCCTTGCCTGGG No data
1139675921_1139675932 17 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675932 16:68523546-68523568 TATCTGGGGAAAGCCTTGCCTGG No data
1139675921_1139675929 1 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675929 16:68523530-68523552 CTCGGGGGCACAGAGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139675921 Original CRISPR CGAGGATATTCAATGACCCT GGG (reversed) Intergenic
No off target data available for this crispr