ID: 1139675930

View in Genome Browser
Species Human (GRCh38)
Location 16:68523531-68523553
Sequence TCGGGGGCACAGAGGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139675913_1139675930 23 Left 1139675913 16:68523485-68523507 CCTCCCCACAACCAGCCACATCC No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675912_1139675930 24 Left 1139675912 16:68523484-68523506 CCCTCCCCACAACCAGCCACATC No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675917_1139675930 18 Left 1139675917 16:68523490-68523512 CCACAACCAGCCACATCCCAGGG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675919_1139675930 12 Left 1139675919 16:68523496-68523518 CCAGCCACATCCCAGGGTCATTG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675914_1139675930 20 Left 1139675914 16:68523488-68523510 CCCCACAACCAGCCACATCCCAG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675920_1139675930 8 Left 1139675920 16:68523500-68523522 CCACATCCCAGGGTCATTGAATA No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675921_1139675930 2 Left 1139675921 16:68523506-68523528 CCCAGGGTCATTGAATATCCTCG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675911_1139675930 25 Left 1139675911 16:68523483-68523505 CCCCTCCCCACAACCAGCCACAT No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675915_1139675930 19 Left 1139675915 16:68523489-68523511 CCCACAACCAGCCACATCCCAGG No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data
1139675922_1139675930 1 Left 1139675922 16:68523507-68523529 CCAGGGTCATTGAATATCCTCGT No data
Right 1139675930 16:68523531-68523553 TCGGGGGCACAGAGGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139675930 Original CRISPR TCGGGGGCACAGAGGTATCT GGG Intergenic
No off target data available for this crispr