ID: 1139676949

View in Genome Browser
Species Human (GRCh38)
Location 16:68530293-68530315
Sequence TCCGCGCTCGGGGCTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139676949_1139676963 23 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676963 16:68530339-68530361 GTGCCTCCAACCCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 163
1139676949_1139676961 16 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676961 16:68530332-68530354 GAGGTCGGTGCCTCCAACCCGGG 0: 1
1: 0
2: 1
3: 12
4: 170
1139676949_1139676957 -3 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676957 16:68530313-68530335 GGACCTGGAGCGGAGAAGAGAGG 0: 1
1: 0
2: 1
3: 54
4: 371
1139676949_1139676966 29 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676966 16:68530345-68530367 CCAACCCGGGGCCGCGGTCGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
1139676949_1139676960 15 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676960 16:68530331-68530353 AGAGGTCGGTGCCTCCAACCCGG 0: 1
1: 0
2: 0
3: 10
4: 102
1139676949_1139676959 1 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676959 16:68530317-68530339 CTGGAGCGGAGAAGAGAGGTCGG 0: 1
1: 0
2: 7
3: 48
4: 472
1139676949_1139676962 17 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676962 16:68530333-68530355 AGGTCGGTGCCTCCAACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 54
1139676949_1139676967 30 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676967 16:68530346-68530368 CAACCCGGGGCCGCGGTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139676949 Original CRISPR TCCGCGCTCGGGGCTGGCGG CGG (reversed) Intronic
900103877 1:974080-974102 CCCGGGCTCCGGGCTGGCCGGGG + Intronic
900599632 1:3497509-3497531 TCTGCCCTCCGGGGTGGCGGGGG - Intronic
900626630 1:3611542-3611564 TCCGGGCTGGGGGCGGGCCGGGG - Intergenic
900658549 1:3772119-3772141 CCCACGCTCGGTGCTCGCGGCGG - Intergenic
901066595 1:6497338-6497360 GCCGCGCGGGGGGCGGGCGGCGG + Intronic
901084626 1:6602981-6603003 CCCGCGCTCGCGGGGGGCGGTGG - Intronic
902148219 1:14420950-14420972 CCCCCTCTCTGGGCTGGCGGAGG - Intergenic
902940984 1:19799973-19799995 GGCGCGCTCGGGGCAGGCGGCGG - Intergenic
903184703 1:21622516-21622538 TCCGCGCTCCCGGCTCCCGGCGG + Intronic
903514753 1:23902907-23902929 CCCGCCCTCGAGGATGGCGGCGG - Intronic
903589946 1:24447168-24447190 TCTGCGCTCTGGGCTGGGGCCGG + Intronic
904049712 1:27631883-27631905 TCCAGGCTCTGGGCTGGCCGGGG + Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905890541 1:41516110-41516132 GCCCAGCTCGGGGCTGGCCGGGG + Intronic
908534800 1:65067283-65067305 TCCGCACTGGGGTCTGGGGGCGG - Intergenic
910892192 1:92029903-92029925 TGCGCGCTCCGGGCTGGGCGCGG + Intergenic
912707643 1:111926764-111926786 TCATCGCTCGGGGCTGACGCAGG + Intronic
915914816 1:159934548-159934570 TCCGCACCCGGGGCTGCAGGCGG + Exonic
916068232 1:161153486-161153508 TGGGGGCTCGGGGCTGGGGGAGG + Intronic
917817641 1:178725982-178726004 TCCGGGGCCGGGGCTGGCGGGGG - Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923127040 1:231041134-231041156 TCCGCCCTCGGGGAGGGCCGGGG - Intergenic
1062760152 10:11697-11719 GCCGGGCTCGGGCCCGGCGGAGG + Intergenic
1063200996 10:3785313-3785335 GCCGCGCACGGGGCGGGCGCGGG - Intergenic
1065024211 10:21526072-21526094 TCCTCCCCCGGGGCTGGCGGCGG - Intergenic
1065554851 10:26905485-26905507 GCCCCGCTCTGGGCTGGCTGAGG + Intergenic
1067064148 10:43094207-43094229 TCCTCCCTGGGGGCTGGGGGTGG - Intronic
1067830938 10:49610689-49610711 CCAGCGCTCGGCCCTGGCGGAGG + Exonic
1069486754 10:68828300-68828322 TCCGCGCTCACAGCTGGCGCGGG - Intronic
1072891473 10:99329200-99329222 TCCCCGCTGGAGGCTGGAGGTGG - Exonic
1073812347 10:107164641-107164663 GCCGCGGTGGGGGCGGGCGGAGG + Intergenic
1074585895 10:114767917-114767939 CCCGGGCTCGGGGCTGCCGGGGG - Intergenic
1074591835 10:114821626-114821648 GCCTCGCGCGGGGCTGGAGGCGG - Intergenic
1075037350 10:119080524-119080546 TCCCCGCGCGGGCCGGGCGGCGG + Intronic
1075054417 10:119207236-119207258 TCCGCTTTCCGGGCTGGCGACGG + Intergenic
1075334447 10:121598299-121598321 ACTGCTCTCCGGGCTGGCGGGGG - Exonic
1076096084 10:127736233-127736255 CCCGCGCTGTGGGGTGGCGGAGG - Intergenic
1076850130 10:133088559-133088581 GCTGCGCCTGGGGCTGGCGGAGG - Intronic
1076870279 10:133189536-133189558 CCCGCACTTGGGGCTGGCTGGGG - Intronic
1079101422 11:17544402-17544424 GCCGCCCTCGGAGCTGGGGGCGG + Intronic
1079128542 11:17734978-17735000 TCCTCGCTTCGGGCAGGCGGTGG - Exonic
1083301043 11:61739743-61739765 TCACCGCTCGGGGCTGGGGGTGG + Intronic
1084658137 11:70531321-70531343 TCTGTGCTGGGGGCTGGTGGTGG + Intronic
1086455613 11:86956069-86956091 TCCCCGCTGGCGGCTGGAGGTGG - Intergenic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089214903 11:116829524-116829546 TCAGGGCTTGGGGCTGGTGGAGG + Intergenic
1089507194 11:118971839-118971861 TCCACCTTCGGGGCTGGCAGAGG - Exonic
1089647022 11:119887000-119887022 TCCATGCCCTGGGCTGGCGGCGG + Intergenic
1090807217 11:130210084-130210106 GCCCAGCTTGGGGCTGGCGGGGG - Exonic
1092391285 12:8082260-8082282 TCCGCTGTCGGCGCTGCCGGGGG - Exonic
1096503576 12:52079872-52079894 GCCGCGCGCGGTGCAGGCGGTGG + Intergenic
1102973536 12:117190116-117190138 TCCGCGCGCGGGGCGGCCGCGGG + Intronic
1103562411 12:121799703-121799725 TACGCGCTCGCAGCTGGGGGGGG + Intronic
1104376269 12:128267355-128267377 GCTGCGCTTCGGGCTGGCGGCGG + Intergenic
1104803473 12:131570283-131570305 TCTGAGCTCGGAGCTGGTGGAGG + Intergenic
1106304061 13:28494928-28494950 TCAGGGCGCGGGGCCGGCGGCGG - Exonic
1106840591 13:33682047-33682069 GCCCCTCTCTGGGCTGGCGGAGG + Intergenic
1117092796 14:52267720-52267742 GCCGCGCGCGGAGCTGCCGGGGG + Exonic
1118339094 14:64879819-64879841 CCCGAGCCCGGGGGTGGCGGCGG + Exonic
1119520229 14:75279474-75279496 TCCGTGCTCCAGGCTGCCGGGGG - Intronic
1120974166 14:90234473-90234495 TCCCCACTCAGGGCTGGCTGAGG + Intergenic
1122145010 14:99683964-99683986 TCAGCGCTCTGGCCCGGCGGCGG - Intergenic
1122904553 14:104795770-104795792 TCCGGGCGCGGGGCGGGCGCGGG - Intergenic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1124061641 15:26298484-26298506 ACCCCGCTCTGGGCTGGCCGAGG - Intergenic
1125508763 15:40281966-40281988 TCGATGCTCGGGGCTGGCCGCGG + Exonic
1127789912 15:62390552-62390574 TCCGCGCCCGGAGCCAGCGGCGG + Intronic
1131197104 15:90364342-90364364 TCCCTGCTCATGGCTGGCGGGGG - Intronic
1131941382 15:97569998-97570020 TCGGGGCTGGGGGCTGGGGGAGG - Intergenic
1132552752 16:560190-560212 TCAGCTCTCGGGGCGCGCGGTGG - Intergenic
1134134139 16:11668561-11668583 CGCGCGCTCGGGCCGGGCGGGGG + Intronic
1137236239 16:46621002-46621024 TCCAACCTCGGGGCGGGCGGAGG + Intronic
1138591363 16:58001085-58001107 GCCGGGCTCGGGGCAGGCAGGGG + Intronic
1139451230 16:67029358-67029380 GCCGCGCTCGGGGCTTGCGCGGG - Exonic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1140091937 16:71846020-71846042 TCCGGGGCCGGGGATGGCGGCGG + Exonic
1140209568 16:72959814-72959836 TCCTCTCTCAGGGGTGGCGGGGG + Exonic
1141054419 16:80803473-80803495 TCCGGGCTCGGGCGTGGGGGTGG - Intronic
1141527046 16:84618242-84618264 TCCGCGGTGGGGGCTGGAGTAGG + Intergenic
1141686805 16:85574882-85574904 TCTGCGCTCCAGGCAGGCGGGGG + Intergenic
1142335976 16:89490014-89490036 TCCGGGTTCGGGGCAGCCGGGGG - Intronic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1143022957 17:3926112-3926134 TCAGCCCTGGGGGCTGGGGGCGG - Intronic
1148603119 17:48908837-48908859 CCGGAGCTCGGGGCTGGGGGAGG - Intronic
1151725045 17:75878654-75878676 GCCGAGCTGGGGGCGGGCGGGGG - Intergenic
1152105238 17:78324815-78324837 TCCTCTCTCGGGGCTGGCCCCGG + Intergenic
1152379261 17:79934050-79934072 GCAGCCCTCAGGGCTGGCGGTGG - Exonic
1152809879 17:82376368-82376390 GCCGGGCTGGGGGCTGGAGGGGG - Intergenic
1152953059 18:12051-12073 GCCGGGCTCGGGCCCGGCGGAGG + Intergenic
1153935023 18:9913882-9913904 TGCGCGCTCGCGGCTTGCCGCGG - Intergenic
1154294574 18:13137332-13137354 TCCGCGCTCGGCGCGAGCTGTGG + Intergenic
1155146958 18:23092292-23092314 TGCGAACTCGGGGCTGGTGGAGG + Intergenic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1160613611 18:80108179-80108201 TCAGGGCTGGAGGCTGGCGGCGG + Intergenic
1160793498 19:933517-933539 TCCTCGCCCGGGGCTGGAGCTGG + Intronic
1160909210 19:1467194-1467216 GCCGCGCTCGGGGCAGGCCGAGG - Exonic
1161060180 19:2210878-2210900 TCCGCACTCGGGGAGAGCGGGGG - Intronic
1161069650 19:2253709-2253731 TCCTCGCTCAGGGCCGGGGGCGG + Exonic
1161366095 19:3880684-3880706 TCCCAGCTCAGGGCTGGCAGAGG - Exonic
1161396911 19:4049534-4049556 TGCCCTCTCGAGGCTGGCGGCGG + Intronic
1161779221 19:6279954-6279976 TGCGCGACCCGGGCTGGCGGTGG - Intergenic
1162396406 19:10420337-10420359 TCCCCGCTCCGGGCTGGGAGGGG - Intronic
1165157217 19:33796038-33796060 GCGGCGCCCGGGGCTGGGGGCGG - Intronic
1167494515 19:49809666-49809688 CGCGAGCTCGGGGCTGGCTGTGG - Intronic
1168254941 19:55159998-55160020 TCCGGGGTCGGGGCTGCTGGGGG + Exonic
1168722578 19:58562300-58562322 GCCGCACTCGGGGCAGGCGAAGG + Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
936585818 2:113756686-113756708 TCCGGGCTGGGGACTGGGGGCGG - Exonic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
942678190 2:178450742-178450764 GCGGCGCGCGGGGCGGGCGGAGG - Intronic
944114289 2:196171099-196171121 TCCGCGCGGGGGGCGGCCGGCGG - Intronic
944715882 2:202376100-202376122 CCCTCGTTCGGGGCTGGCTGAGG - Intergenic
946310620 2:218880789-218880811 ACCGCCCTCGGGGGGGGCGGGGG - Exonic
947623442 2:231604959-231604981 TCCTGGCCCGGGGCAGGCGGGGG + Intergenic
1171209141 20:23303567-23303589 TCCCCCCGCGGGGCTGGCTGAGG + Intergenic
1171346429 20:24469544-24469566 CCGGCGCTCGGGGCAGCCGGGGG + Exonic
1176077191 20:63253979-63254001 TCGGCGCCCGGGGCCGGCTGCGG + Intronic
1176077284 20:63254269-63254291 TCCCCCCTCGGAGCTGGCGCGGG + Intronic
1178561501 21:33642904-33642926 CCCGTCCTCGGGGGTGGCGGCGG + Intronic
1178948477 21:36966868-36966890 GCCGCGCCCAGGGCTGGTGGCGG + Intronic
1180707464 22:17818258-17818280 TCCTCGCCCGGGGGTGGCGGTGG + Exonic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181283532 22:21736166-21736188 TCGGCCGGCGGGGCTGGCGGTGG + Intergenic
1183397667 22:37581753-37581775 TCCTCACTCCGGGCTGGCAGGGG - Intronic
1183708125 22:39487520-39487542 TCCTGGCTCGGGGCTGGCCTGGG - Exonic
1184361975 22:44024315-44024337 GCCGCGCGTGGGGCCGGCGGCGG - Intronic
1184680621 22:46070805-46070827 ACAGCGCTCGGGGCCGACGGTGG - Intronic
1185274866 22:49946143-49946165 TCTGCGCTGGGGCCAGGCGGCGG + Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
949105419 3:196894-196916 TCCGCACCCGGGGCTGTCCGCGG - Exonic
950150264 3:10681287-10681309 TCCACGCTTGGGGGTGGTGGAGG + Intronic
950650240 3:14402679-14402701 TCGGGGCTCGGCGTTGGCGGCGG - Exonic
950940042 3:16883894-16883916 TCCGTGCGCGGGGCTGGGGCAGG + Intronic
951719804 3:25686867-25686889 TCCGGGTCCGGTGCTGGCGGCGG - Intergenic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
954375965 3:50194288-50194310 ACCGCGCGCTGGGCTGGGGGAGG + Intronic
961450305 3:126999573-126999595 TCCGGGCTGAGGGCAGGCGGGGG - Intronic
965728530 3:171745829-171745851 GCCCCTCTCTGGGCTGGCGGAGG + Intronic
968051519 3:195658135-195658157 TCGGCGCTTGGCGCTGGCGCTGG + Intergenic
968136038 3:196220153-196220175 GCTGCGCGCCGGGCTGGCGGAGG + Intronic
968161655 3:196432062-196432084 TCCCAGGTCTGGGCTGGCGGGGG + Intronic
969717411 4:8874443-8874465 TCTGTGCTCGGTGCTGGTGGCGG + Intergenic
974385955 4:61201957-61201979 TGGGCGCTCGGGTCTGGCGCGGG + Intronic
974839844 4:67287117-67287139 TCCCCTCTCTGGGCTGGCCGAGG - Intergenic
978929838 4:114296521-114296543 GCCTCTCTCTGGGCTGGCGGAGG - Intergenic
983649753 4:170026387-170026409 TCCGCGCTCCCGGCAGCCGGCGG - Exonic
983941600 4:173538779-173538801 TCTGCGCTCCGGGCGGGTGGAGG + Intergenic
997239123 5:132294183-132294205 TCAGCGCTCGGGGGTGGCTGGGG + Intronic
997326480 5:133026179-133026201 TCCACGCGTGGGGTTGGCGGAGG + Intronic
1001396004 5:171419964-171419986 TGCGCCCTCCGGGCTGGCGCAGG - Exonic
1002793153 6:449926-449948 GCCCCTCTCTGGGCTGGCGGAGG + Intergenic
1002817337 6:693118-693140 TACACGCTCGGCGCTCGCGGCGG - Intergenic
1003111343 6:3253967-3253989 TCCGCCCGTGGCGCTGGCGGGGG + Intronic
1005905717 6:30260298-30260320 TCGGTGTTCGGGGCTGACGGCGG + Intergenic
1005982588 6:30847824-30847846 TCCACACTTGTGGCTGGCGGCGG - Intergenic
1006170107 6:32087591-32087613 GCCGGGATCAGGGCTGGCGGTGG + Intronic
1006396229 6:33789131-33789153 TGCGCGCCAGGGGCGGGCGGGGG - Exonic
1006414038 6:33893006-33893028 TCCCCCCTCGGGGTTGGCAGGGG + Intergenic
1007666542 6:43516835-43516857 TCCGCGCGCGGGGCTAGCGCGGG - Exonic
1008844787 6:55950250-55950272 TCCCCTCTCTGGGCTGGCCGAGG + Intergenic
1010794837 6:80106771-80106793 TCCTGGCGCGGGGCTGGCGCGGG + Exonic
1012399348 6:98831781-98831803 GCCGCGCTTGGGGGTGGGGGTGG + Intergenic
1013030225 6:106325584-106325606 TCCGCGCTCCGGTGGGGCGGCGG + Exonic
1018398781 6:163401982-163402004 TCCATGCTGGGGGCTGGCCGAGG + Intergenic
1018582237 6:165317261-165317283 GCCACCCTCTGGGCTGGCGGGGG + Intergenic
1019343004 7:517352-517374 TCCGCGCGCGGGGAGGGCGCGGG - Intronic
1019431000 7:999713-999735 TGCGCGCTGGGGGCAGGGGGCGG - Intronic
1019473114 7:1231641-1231663 TCCCCGCCCTGGGCTGGCCGAGG + Intergenic
1020461407 7:8433698-8433720 TCGGCGCTCGAGGCCGGCAGGGG + Intergenic
1021573820 7:22090272-22090294 ACCCCTCTCTGGGCTGGCGGAGG + Intergenic
1024089090 7:45920962-45920984 TCCGCGCACACGGCGGGCGGAGG + Exonic
1025959232 7:66205645-66205667 TCCGCGCTCGGGGGCGGGGTTGG - Intronic
1026665262 7:72336166-72336188 TCAGCGCTAGGGGCCGGAGGTGG + Intronic
1028719477 7:94012287-94012309 TCCCCTTTCTGGGCTGGCGGAGG - Intergenic
1028792845 7:94873265-94873287 ACCGTGCTCTGGGCTGGCAGTGG + Intergenic
1029109264 7:98204057-98204079 TCCGTGCTCCGGGCCGGTGGCGG - Exonic
1029372491 7:100158427-100158449 GCCGCGCGCGGAGCTGGCAGGGG - Exonic
1029441091 7:100586902-100586924 CCCGGGCTGGGGGCGGGCGGGGG + Intronic
1033253214 7:139777856-139777878 TCGGGGCTCGGGGCTCGGGGCGG + Intronic
1035747916 8:1974577-1974599 GCGGTGCTCGGGGCTCGCGGGGG - Intronic
1036482430 8:9150818-9150840 TCCCCGTCCCGGGCTGGCGGAGG - Intronic
1036773450 8:11594069-11594091 TCCTGGCTCCGGGCTGGCCGGGG - Intergenic
1037882366 8:22579394-22579416 TGCGGGCTGGGGGCTGGAGGAGG - Exonic
1038039749 8:23714675-23714697 TCCGCTCCCGCGGCGGGCGGCGG - Intergenic
1039454426 8:37697747-37697769 GCCGCCCTCGGCGCTGGTGGGGG + Exonic
1041051569 8:53939647-53939669 TCCCCGCTCCGGGCTGGCCTGGG - Exonic
1048472150 8:134713097-134713119 GCCGCGCTCGGCGCCGGGGGAGG - Intergenic
1049756238 8:144312366-144312388 TCGGAGCTCGGGGCTGGGGAGGG + Intronic
1049761522 8:144333954-144333976 TCCGGGCGCGGGGTGGGCGGCGG + Exonic
1049828619 8:144685827-144685849 GCCGCGCACTGGGCCGGCGGCGG - Intergenic
1051079587 9:13279285-13279307 TCGGCGCTTGGGGGTGGGGGTGG - Intronic
1059375402 9:113876647-113876669 TCCGAGCCCGGGGCCGGAGGGGG - Intronic
1059470938 9:114504722-114504744 TCGGCGGCCGGGGCGGGCGGCGG - Exonic
1059483707 9:114611519-114611541 TCCGCGTCCCGGGGTGGCGGCGG + Exonic
1060230233 9:121820521-121820543 ACCCCGCTCGGGGCTGCCTGGGG - Intergenic
1061905174 9:133693004-133693026 TCGGGGCTGGGGGCTGGCAGGGG - Intronic
1062282083 9:135756680-135756702 TCTGCCCTCGGCCCTGGCGGGGG + Intronic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062413953 9:136438821-136438843 TCCAGGCTCAGGGCAGGCGGTGG + Exonic
1062461953 9:136665919-136665941 GCCGCGCGCGGAGCTGGGGGCGG + Intronic
1062696069 9:137877256-137877278 TCCACGCACGGGGCTGGCTCCGG - Intergenic
1189002823 X:36963828-36963850 CGCGCGCTCGGCGCTGGTGGGGG - Intergenic
1201076917 Y:10195979-10196001 TCCGCGGTGGGGACTGGGGGCGG + Intergenic