ID: 1139676949

View in Genome Browser
Species Human (GRCh38)
Location 16:68530293-68530315
Sequence TCCGCGCTCGGGGCTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139676949_1139676967 30 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676967 16:68530346-68530368 CAACCCGGGGCCGCGGTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1139676949_1139676957 -3 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676957 16:68530313-68530335 GGACCTGGAGCGGAGAAGAGAGG 0: 1
1: 0
2: 1
3: 54
4: 371
1139676949_1139676961 16 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676961 16:68530332-68530354 GAGGTCGGTGCCTCCAACCCGGG 0: 1
1: 0
2: 1
3: 12
4: 170
1139676949_1139676959 1 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676959 16:68530317-68530339 CTGGAGCGGAGAAGAGAGGTCGG 0: 1
1: 0
2: 7
3: 48
4: 472
1139676949_1139676962 17 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676962 16:68530333-68530355 AGGTCGGTGCCTCCAACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 54
1139676949_1139676966 29 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676966 16:68530345-68530367 CCAACCCGGGGCCGCGGTCGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
1139676949_1139676963 23 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676963 16:68530339-68530361 GTGCCTCCAACCCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 163
1139676949_1139676960 15 Left 1139676949 16:68530293-68530315 CCGCCGCCAGCCCCGAGCGCGGA 0: 1
1: 0
2: 2
3: 13
4: 194
Right 1139676960 16:68530331-68530353 AGAGGTCGGTGCCTCCAACCCGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139676949 Original CRISPR TCCGCGCTCGGGGCTGGCGG CGG (reversed) Intronic