ID: 1139681093

View in Genome Browser
Species Human (GRCh38)
Location 16:68563880-68563902
Sequence CCCTTCCAGTGTAAGGAATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 14, 3: 93, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139681089_1139681093 14 Left 1139681089 16:68563843-68563865 CCTCACTCAACACGAGGTCACAC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1139681093 16:68563880-68563902 CCCTTCCAGTGTAAGGAATGTGG 0: 1
1: 0
2: 14
3: 93
4: 614
1139681088_1139681093 15 Left 1139681088 16:68563842-68563864 CCCTCACTCAACACGAGGTCACA 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1139681093 16:68563880-68563902 CCCTTCCAGTGTAAGGAATGTGG 0: 1
1: 0
2: 14
3: 93
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139681093 Original CRISPR CCCTTCCAGTGTAAGGAATG TGG Exonic
900086414 1:899949-899971 CCAAACCAGTGTGAGGAATGAGG + Intergenic
901635281 1:10667620-10667642 CCCATCCAGGGCAAGGGATGAGG - Intronic
902797346 1:18808150-18808172 CCCTTCCAGTGGCAGGAGGGAGG + Intergenic
903428661 1:23274385-23274407 GAATTTCAGTGTAAGGAATGAGG - Intergenic
903437508 1:23362363-23362385 CCATACCACTGTAACGAATGTGG - Exonic
905099914 1:35510920-35510942 CCTTTTAAATGTAAGGAATGTGG + Intronic
905750900 1:40462900-40462922 CCTTTCAGATGTAAGGAATGTGG + Exonic
905754285 1:40495370-40495392 CCTTTCAGATGTAAGGAATGTGG + Exonic
905754296 1:40495454-40495476 CCCTTTGAATGTGAGGAATGTGG + Exonic
905754327 1:40495790-40495812 CCCTACAAATGTAAAGAATGTGG + Exonic
906229694 1:44151094-44151116 TCCTATGAGTGTAAGGAATGTGG - Intergenic
906229728 1:44151508-44151530 CCCTTTGAATGTAATGAATGTGG - Intergenic
911587276 1:99705225-99705247 CCCTTGCAGGGTGTGGAATGGGG - Intergenic
913371926 1:118109069-118109091 TCCTTTCATTGTAAGGAATTAGG - Intronic
916391222 1:164333111-164333133 TCCTTCCAGTTTAAGGATTTAGG - Intergenic
917798366 1:178548367-178548389 GCCTCCCAGCATAAGGAATGTGG + Intronic
918177091 1:182056398-182056420 CCCTACCAGTGTGAGGACTGCGG - Exonic
920531521 1:206706072-206706094 CACTTCCAGTGTAATTAAGGCGG + Intronic
922687521 1:227655208-227655230 CCCTACCAATGTGAAGAATGTGG + Exonic
922687548 1:227655544-227655566 CCCTACAAATGTAAAGAATGTGG + Exonic
924761086 1:246987022-246987044 CCATACAAGTGTGAGGAATGTGG - Exonic
924761107 1:246987274-246987296 CCCTACAAATGTGAGGAATGTGG - Exonic
924761128 1:246987526-246987548 CCCTACAAGTGTGAAGAATGTGG - Exonic
924766609 1:247037843-247037865 CCCTATGAATGTAAGGAATGTGG - Exonic
924773842 1:247100834-247100856 CCCTACGAATGTAAGGAATGTGG - Exonic
1065849299 10:29773637-29773659 CCCAACCACTGTTAGGAATGGGG - Intergenic
1066486147 10:35846728-35846750 TCTTTCCAGGGTAAGGAAGGAGG - Intergenic
1066676772 10:37896237-37896259 CCCTGTGAATGTAAGGAATGTGG + Intergenic
1066682917 10:37952623-37952645 CCCTATAAATGTAAGGAATGTGG - Exonic
1066682929 10:37952707-37952729 CCCTATGAGTGTAAGGAGTGTGG - Exonic
1066973268 10:42337933-42337955 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1066999444 10:42593694-42593716 CCCTATCAGTGTAATGCATGTGG - Exonic
1067122145 10:43482658-43482680 CCCTATGAGTGTAAGGAATGTGG + Exonic
1067136865 10:43616932-43616954 CCATATCAGTGTAATGAATGTGG + Exonic
1067136889 10:43617184-43617206 CCCTATCACTGTAAGAAATGTGG + Exonic
1067300503 10:45003864-45003886 CCCTACCAGTGCAGTGAATGTGG + Exonic
1067307127 10:45074292-45074314 TCTTTCCAGGGTAAGGAAGGAGG - Intergenic
1067782142 10:49215761-49215783 CCCTTACATTGTATGGAAAGTGG + Intergenic
1069698127 10:70402546-70402568 CACTTCTAGTGGAAGGAAAGGGG - Intergenic
1070681159 10:78450057-78450079 CCCTTCCACTTTAATAAATGAGG - Intergenic
1071374439 10:84988356-84988378 CCCTCTCAGTCTAAGGACTGAGG + Intergenic
1072391571 10:94992902-94992924 CCCCTGCTGTGAAAGGAATGAGG + Intergenic
1072895164 10:99360176-99360198 CCCTCCCAGTGGAGGGACTGGGG + Intronic
1073330991 10:102669724-102669746 CCTCTCTAGTGTTAGGAATGTGG + Intergenic
1076199322 10:128545898-128545920 CACCTACAGTGTAAGGAGTGGGG - Intergenic
1077573576 11:3359341-3359363 CCCTACAAGTGTGAAGAATGTGG - Exonic
1077573600 11:3359593-3359615 CCCTACCAATGTGAAGAATGTGG - Exonic
1083888938 11:65586150-65586172 ACCTTCCATTGTAAGAAAAGAGG - Intronic
1088368061 11:109059776-109059798 CCCTTCCAGTGCAGGGCATATGG + Intergenic
1088989999 11:114945101-114945123 CCCTTCCAGCCTAAGGACTTCGG + Intergenic
1091622441 12:2099516-2099538 CCCTTCCAGAGGCAGGAATCTGG + Intronic
1091821083 12:3475688-3475710 CCCTTTCAGGACAAGGAATGGGG - Intronic
1093395737 12:18679934-18679956 ACCCTCCAGTGTTTGGAATGAGG + Intergenic
1096692732 12:53331031-53331053 CCCTTCCAAGGCAAGGAATGGGG + Intronic
1100220145 12:92496148-92496170 CCCTTCCTGTATAAGGAACGAGG - Intergenic
1101436219 12:104666949-104666971 TCCTGCCAGTGTATGGCATGGGG + Intronic
1104586146 12:130049496-130049518 CCCTTCCTGTGTAAGGTAGCTGG + Intergenic
1105061526 12:133156036-133156058 CCCTATGAATGTAAGGAATGTGG + Exonic
1105061532 12:133156120-133156142 CCCTATGAGTGTAAAGAATGTGG + Exonic
1105061571 12:133156540-133156562 CCTTTTGAGTGTAAGGATTGTGG + Exonic
1105228887 13:18469658-18469680 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1105254559 13:18734257-18734279 CCCTATGAATGTAAGGAATGTGG + Intergenic
1106000738 13:25720602-25720624 GCCTTCCTGTGTAAGGGAAGAGG - Intronic
1106574050 13:30957734-30957756 CCCTTCCAGGGTAGGGGCTGTGG + Intronic
1106868575 13:33994513-33994535 CCTTTCCTCTGTGAGGAATGTGG + Intergenic
1107742482 13:43466066-43466088 CAGTTCCAGTTAAAGGAATGTGG + Intronic
1111948692 13:94692394-94692416 ACCTTCCAGTGTAGGGCATGTGG + Intergenic
1114013164 14:18396550-18396572 CCCTACCAATGTGAAGAATGTGG - Intergenic
1114013169 14:18396634-18396656 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1115302813 14:31903331-31903353 CACTTCCAATGAAAGGAATATGG - Intergenic
1115960895 14:38835725-38835747 CCCTTCAAGTGTTAGCAGTGAGG + Intergenic
1120349462 14:83334784-83334806 CCCTTCCAGAGAAAATAATGGGG - Intergenic
1202888693 14_KI270722v1_random:134400-134422 CCCTATCAGTGTAGTGAATGTGG + Intergenic
1123502376 15:20901137-20901159 GCCTTCAAATGTAAAGAATGTGG - Intergenic
1123502381 15:20901221-20901243 CCTATCAAGTGTAAGGACTGTGG - Intergenic
1123559626 15:21474821-21474843 GCCTTCAAATGTAAAGAATGTGG - Intergenic
1123559631 15:21474905-21474927 CCTATCAAGTGTAAGGAATGTGG - Intergenic
1123595862 15:21912118-21912140 GCCTTCAAATGTAAAGAATGTGG - Intergenic
1123595867 15:21912202-21912224 CCTATCAAGTGTAAGGACTGTGG - Intergenic
1123778963 15:23606644-23606666 CCCTCCCAGTGGAAGGAAGTGGG - Intronic
1126930081 15:53638092-53638114 CCTTTTAACTGTAAGGAATGAGG + Intronic
1128043590 15:64597057-64597079 CCCTTTAAGTGTCAGGAATCTGG - Intronic
1128169562 15:65499185-65499207 CACTTCCTGTGTAAGCACTGAGG - Intronic
1128305805 15:66598251-66598273 GCCTTCCTGTGGTAGGAATGGGG + Intronic
1128534541 15:68480704-68480726 CCCTGCCAGCGGAAGGAATGAGG - Intergenic
1130515202 15:84621108-84621130 CCCTTCCAGTGTGCCGAGTGTGG + Exonic
1130515229 15:84621276-84621298 CCCTACGAATGTAAAGAATGCGG + Exonic
1131688101 15:94793144-94793166 CCCTGTCAGTGGAATGAATGGGG + Intergenic
1202967971 15_KI270727v1_random:201981-202003 GCCTTCAAATGTAAAGAATGTGG - Intergenic
1202967976 15_KI270727v1_random:202065-202087 CCTATCAAGTGTAAGGACTGTGG - Intergenic
1134209942 16:12267697-12267719 CCGTTCCATTGCGAGGAATGCGG - Intronic
1136277910 16:29190358-29190380 CCCTTTCTGTGTATGGTATGAGG + Intergenic
1136564479 16:31061735-31061757 CCCTTCCACTGTAACGCATGTGG - Exonic
1136564496 16:31061819-31061841 CCCTTCCGCTGTGAGGAGTGCGG - Exonic
1136644667 16:31601644-31601666 CCCTACAAATGTAAAGAATGTGG - Intergenic
1136660503 16:31755630-31755652 CCCTACAAATGTAAAGAATGTGG + Intronic
1139484417 16:67247854-67247876 CCCCTCAAATGGAAGGAATGAGG - Intronic
1139681093 16:68563880-68563902 CCCTTCCAGTGTAAGGAATGTGG + Exonic
1140047156 16:71448328-71448350 CCCTTTCAGTGTAAGGAGTGTGG - Exonic
1140047173 16:71448496-71448518 CCCTATCAATGTAAGGAATGTGG - Exonic
1140047203 16:71448748-71448770 CCCTATGAGTGTAATGAATGCGG - Exonic
1140047218 16:71448916-71448938 CCCTATCAGTGTAAAGAGTGTGG - Exonic
1140047238 16:71449168-71449190 CCCTATCAGTGCAAGGAATGTGG - Exonic
1140050413 16:71475879-71475901 CCCTATCAGTGTGAGGAGTGTGG - Exonic
1140464553 16:75169825-75169847 CCTTTCGAGTGTCCGGAATGTGG + Exonic
1142296723 16:89228386-89228408 CCCTATAAATGTAAGGAATGTGG + Exonic
1142296734 16:89228554-89228576 CCTTTCTAATGTAAAGAATGTGG + Exonic
1143198084 17:5092006-5092028 CCCTTTGAATGTAAAGAATGTGG + Exonic
1143199991 17:5106065-5106087 CCCTTCGAATGTAATGAATGTGG - Exonic
1143210293 17:5181539-5181561 CCCTATGAATGTAAGGAATGTGG - Exonic
1143210345 17:5182116-5182138 CCCTATGAATGTAAGGAATGTGG - Exonic
1143210408 17:5182692-5182714 CCCTATGAATGTAAGGAATGTGG - Exonic
1143731332 17:8884587-8884609 GCCTTCCAGCGTAAAGACTGGGG + Intronic
1144487059 17:15675473-15675495 CCCTACAAGTGTAAAGAATGTGG + Intronic
1144491578 17:15717033-15717055 CCCTATGAGTGTAATGAATGTGG + Exonic
1144601813 17:16622529-16622551 CCCTACACCTGTAAGGAATGTGG - Exonic
1144913969 17:18706843-18706865 CCCTACAAGTGTAAAGAATGTGG - Intronic
1145903356 17:28501983-28502005 CCCTTTCAGTCCAAGGACTGTGG + Intronic
1147345632 17:39791553-39791575 CCATTCCAGTGTAATCAGTGTGG - Exonic
1147364570 17:39951785-39951807 CCCTTCCAGTGGAATGAAATAGG + Intergenic
1148456201 17:47812866-47812888 CCCTGCCAGTGAAGGGAAAGAGG - Intronic
1149182289 17:53953565-53953587 CCTTTCCAATGTAATGAGTGTGG + Intergenic
1149534080 17:57418680-57418702 GCCTTCCACTTTCAGGAATGTGG - Intronic
1151579756 17:74971462-74971484 CCCTTCCAGGGTGGGGAAAGGGG + Intronic
1154407251 18:14104975-14104997 CCTTTCAAATGTAAAGAATGTGG - Exonic
1154407272 18:14105227-14105249 CACTTCAAATGTAAAGAATGTGG - Exonic
1154407276 18:14105311-14105333 CCTTTCAAGTGTAAGGAATGTGG - Exonic
1154407281 18:14105395-14105417 CCTTTCAGATGTAAGGAATGTGG - Exonic
1154407299 18:14105563-14105585 CCTTTCAAGTGTAAGGAATGTGG - Exonic
1154436469 18:14346363-14346385 CCCTATGAATGTAAGGAATGTGG - Intergenic
1154524566 18:15270467-15270489 CCTTTCAAATGTAAAGAATGTGG + Intergenic
1155094885 18:22546046-22546068 CCTCACCAGTGTACGGAATGTGG + Intergenic
1156240171 18:35246143-35246165 CCTTATCAGTGTAATGAATGTGG + Exonic
1156480712 18:37434754-37434776 CCCTTTCAGTGTAGGGAGTAGGG + Intronic
1157287381 18:46386188-46386210 CCTCGCCAGTGTAAGAAATGAGG - Intronic
1159945394 18:74441147-74441169 CCTTTCAGGTTTAAGGAATGAGG + Intronic
1160038830 18:75325225-75325247 TCCTTCCTGTTTAAGGAAGGGGG + Intergenic
1161174693 19:2834286-2834308 CCCTACGAGTGTCAGGAGTGTGG + Exonic
1161174751 19:2834706-2834728 CCCTACAGGTGTCAGGAATGTGG + Exonic
1161177328 19:2852828-2852850 CCATATAAGTGTAAGGAATGTGG + Exonic
1161177407 19:2853668-2853690 CCCTATGAATGTAAGGAATGTGG + Exonic
1161187783 19:2933802-2933824 CCCTTTGAGTGTAAGCATTGTGG - Exonic
1161187818 19:2934054-2934076 CCCTATGAATGTAAGGAATGCGG - Exonic
1161187839 19:2934306-2934328 CCCTATGAGTGTAAGGAGTGTGG - Exonic
1162234352 19:9295542-9295564 CCCTATGAATGTAAGGAATGTGG - Exonic
1162234369 19:9295710-9295732 CCCTATGAATGTAAGGAATGTGG - Exonic
1162234413 19:9296046-9296068 CCCTATGAATGTAAGGAATGTGG - Exonic
1162234435 19:9296214-9296236 CCCTATAAATGTAAGGAATGTGG - Exonic
1162234490 19:9296718-9296740 CCCTATCAGTGCAAGGAATGTGG - Exonic
1162239897 19:9342589-9342611 CCTTATCAATGTAAGGAATGTGG + Exonic
1162239931 19:9342925-9342947 CCCTTTGAATGTCAGGAATGTGG + Exonic
1162243751 19:9381346-9381368 CCCTATGACTGTAAGGAATGTGG + Exonic
1162247412 19:9413516-9413538 CCATTCACGTGTATGGAATGTGG - Exonic
1162247439 19:9413768-9413790 CCCTATGAATGTAAGGAATGTGG - Exonic
1162247479 19:9414188-9414210 CCCTATGAGTGTAAGGAGTGTGG - Exonic
1162247490 19:9414272-9414294 CCCTACAAATGTAAGGAATGTGG - Exonic
1162253443 19:9466710-9466732 CCCTATAAATGTAAGGAATGTGG - Exonic
1162253520 19:9467718-9467740 CCCTATGGGTGTAAGGAATGTGG - Exonic
1162253541 19:9467886-9467908 CCCTATGAATGTAAGGAATGTGG - Exonic
1162260397 19:9528936-9528958 CCCTATGAATGTAAGGAATGTGG - Exonic
1162260429 19:9529188-9529210 CCCTACAAATGTAAGGAATGTGG - Exonic
1162265088 19:9566328-9566350 CCCTTTGAATGTAAGGTATGTGG - Exonic
1162265104 19:9566496-9566518 CCTTATCAATGTAAGGAATGTGG - Exonic
1162265111 19:9566580-9566602 CCCTATGAATGTAAGGAATGTGG - Exonic
1162265120 19:9566664-9566686 CCCTACGAATGTAAGGAATGTGG - Exonic
1162270435 19:9610297-9610319 CCCTTCGTATGTAAAGAATGTGG - Exonic
1162270458 19:9610549-9610571 CCCTATCAGTGTAAGGAATGTGG - Exonic
1162270468 19:9610633-9610655 CCCTATGAATGTAAGGAATGTGG - Exonic
1162270499 19:9611053-9611075 CCCTACAAATGTAAGGAATGTGG - Exonic
1162275741 19:9653097-9653119 CCCTATCAGTGTAAGGAATGTGG - Exonic
1162275751 19:9653181-9653203 CCCTATGAATGTAAGGAATGTGG - Exonic
1162275783 19:9653601-9653623 CCCTACAAATGTAAGGAATGTGG - Exonic
1162280221 19:9690487-9690509 CACTATCAGTGTAAGGAATGTGG - Exonic
1162280230 19:9690571-9690593 CCCTATGAATGTAAGGAATGTGG - Exonic
1162284003 19:9724297-9724319 CCCTATCAGTGTAACAAATGTGG - Intergenic
1162284012 19:9724381-9724403 CCCTATGAATGTAAGGAATGTGG - Intergenic
1162284046 19:9724800-9724822 CCGTACAAATGTAAGGAATGTGG - Intergenic
1162594503 19:11616999-11617021 CCCTATGATTGTAAGGAATGTGG + Exonic
1162598996 19:11652798-11652820 AACTTTGAGTGTAAGGAATGTGG + Intergenic
1162607547 19:11722104-11722126 CCATATGAGTGTAAGGAATGTGG - Exonic
1162614070 19:11781832-11781854 CCCTATAAGTGTAAAGAATGTGG + Exonic
1162616639 19:11806593-11806615 CCGTACAAATGTAAGGAATGTGG + Exonic
1162616696 19:11807181-11807203 CCTTACCAATGTAAGGAATGTGG + Exonic
1162619731 19:11832359-11832381 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162619801 19:11833066-11833088 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162623964 19:11868294-11868316 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162623976 19:11868378-11868400 CCGTATCAATGTAAGGAATGTGG + Exonic
1162628465 19:11905640-11905662 CCCTATGAGTGTAAGCAATGTGG + Intronic
1162628510 19:11906078-11906100 CCCTATGAGTGTAAGCAATGAGG + Intronic
1162629073 19:11911940-11911962 CCCTATGAGTGTAAGCAATGTGG + Intronic
1162629081 19:11912024-11912046 CCCTATGAGTGTAAGCAATGTGG + Intronic
1162633714 19:11949357-11949379 CCCTATGAATGTAAGGAATGTGG + Exonic
1162633725 19:11949441-11949463 CCCTATGAATGTAAGGAATGTGG + Exonic
1162633748 19:11949711-11949733 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162633757 19:11949795-11949817 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162633767 19:11949879-11949901 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162637250 19:11979270-11979292 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162637264 19:11979352-11979374 CCCTATGAGTGTAAGGAATGTGG + Intergenic
1162637289 19:11979622-11979644 CCCTATGAGTGTAAGCAATGTGG + Intergenic
1162637300 19:11979706-11979728 CCCTACGAGTGTAAGCAATGTGG + Intergenic
1162637313 19:11979790-11979812 CCCTATGAGTGTAAGGAATGTGG + Intergenic
1162637328 19:11979976-11979998 CCCTATGAGTGTAAGCAATGTGG + Intergenic
1162637335 19:11980060-11980082 CCCTATGAGTGTAAGCAATGTGG + Intergenic
1162641728 19:12015584-12015606 CCTTACGAGTGTAAGCAATGTGG - Exonic
1162645173 19:12043863-12043885 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162645188 19:12044031-12044053 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162645203 19:12044199-12044221 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162649534 19:12076626-12076648 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162649562 19:12076956-12076978 CCCTATGAATGTAAGGAATGCGG + Exonic
1162649593 19:12077292-12077314 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162653759 19:12112796-12112818 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162656299 19:12133320-12133342 CCCTATGAGTGTAAGCAATGTGG - Exonic
1162663199 19:12187213-12187235 CCCTTTAAATGTAAGCAATGTGG + Exonic
1162663249 19:12187717-12187739 CCCTATGAGTGTAAGCAATGTGG + Exonic
1162663264 19:12187885-12187907 CCCTATCATTGCAAGGAATGTGG + Exonic
1162665585 19:12208581-12208603 CCCTATGAATGTAAGGAATGTGG + Intergenic
1162669888 19:12247674-12247696 CCCTACAAATGTAAGGAATGTGG - Intronic
1162669894 19:12247758-12247780 CCCTTTGAGTGTAAAAAATGTGG - Intronic
1162669906 19:12247926-12247948 CCCTACAAATGCAAGGAATGTGG - Intronic
1162669925 19:12248178-12248200 CCCTACAAATGTAAGGAATGTGG - Intronic
1162669934 19:12248262-12248284 CCCTTTAAGTGTAAAGAATGTGG - Intronic
1162672855 19:12272474-12272496 CCCTATGAATGTAAGGAATGTGG - Exonic
1162672966 19:12273731-12273753 CCCTATGATTGTAAGGAATGTGG - Exonic
1162678439 19:12319081-12319103 CCCTATGAGTGTAAGCAATGCGG - Exonic
1162678474 19:12319501-12319523 CGCTATGAGTGTAAGGAATGTGG - Exonic
1162681822 19:12350104-12350126 CCATATGAGTGTAAGGAATGTGG - Exonic
1162686604 19:12390953-12390975 CCATATGAGTGTAAGGAATGTGG - Exonic
1162690937 19:12430643-12430665 CCATATGAGTGTAAGGAATGTGG - Exonic
1162694709 19:12464897-12464919 CCCTATGATTGTAAGGAATGTGG - Exonic
1162694726 19:12465065-12465087 CCCTATCAGTGTAAGCAATGTGG - Exonic
1162702417 19:12526996-12527018 CCCTATGAATGTAAGGAATGCGG - Exonic
1162709389 19:12580552-12580574 CCCTTTCAGTGTAGACAATGTGG - Exonic
1162709458 19:12581308-12581330 CCCTATGAATGTAAGGAATGTGG - Exonic
1162709466 19:12581392-12581414 CCCTATGAATGTAAGGAATGTGG - Exonic
1162715422 19:12628592-12628614 CCCTATAAGTGTAAAGAATGTGG + Exonic
1163056010 19:14718672-14718694 CCCTACGAGTGTAAAGATTGTGG + Exonic
1163857057 19:19711671-19711693 CCTTTTGAGTGTAAGCAATGTGG - Exonic
1163857115 19:19712427-19712449 CCCTACAAATGTAAAGAATGTGG - Exonic
1163868338 19:19794763-19794785 CCCTACAAGTGTGAAGAATGTGG - Exonic
1163868353 19:19794931-19794953 CCCTACAAATGTGAGGAATGTGG - Exonic
1163872632 19:19835588-19835610 CCCTACAAATGTAAAGAATGTGG + Intergenic
1163872640 19:19835672-19835694 CCCTACAGGTGTAAAGAATGTGG + Intergenic
1163872735 19:19836693-19836715 CCCTACAAGTGTGAAGAATGTGG + Intergenic
1163878098 19:19892928-19892950 CCCTACAAGTGTGAAGAATGTGG + Exonic
1163882079 19:19933721-19933743 CCCTACAAGTGTGAAGAATGTGG + Exonic
1163882129 19:19934309-19934331 CCCTACAAGTGTGAAGAATGTGG + Exonic
1163890322 19:20006546-20006568 CCCTACAAATGTAAAGAATGTGG - Exonic
1163911502 19:20198463-20198485 CCCTACAAGTGTGAAGAATGTGG + Exonic
1163931527 19:20397978-20398000 CCCTACAAATGTAAAGAATGTGG - Intergenic
1163946823 19:20544911-20544933 CCCTTCAAGTGTGAAGAATGTGG - Exonic
1163946887 19:20545583-20545605 CCCTTCAAATGTGAAGAATGTGG - Exonic
1163954514 19:20623841-20623863 CCCTACAAGTGTGAAGAATGTGG - Exonic
1163985785 19:20949367-20949389 CCCTACAAATGTAAAGAATGTGG + Exonic
1164002578 19:21117262-21117284 CCCTTCAAATGTGAAGAATGTGG + Exonic
1164002593 19:21117430-21117452 CCCTTCAAATGTGAAGAATGTGG + Exonic
1164009164 19:21183078-21183100 CCCTTCAAATGTGAAGAATGTGG + Exonic
1164019993 19:21293100-21293122 CCCTACAAATGTAAAGAATGTGG - Exonic
1164020020 19:21293437-21293459 CCCTACAAATGTAAAGAATGTGG - Exonic
1164020094 19:21294445-21294467 CCTTTCAAATGTAAAGAATGTGG - Exonic
1164029010 19:21383573-21383595 CCCTACAAATGTGAGGAATGTGG + Intergenic
1164029024 19:21383741-21383763 CCCTACAAATGTGAGGAATGTGG + Intergenic
1164029064 19:21384327-21384349 CCCTACAAGTGTGAAGAATGTGG + Intergenic
1164032832 19:21424373-21424395 CCCTACAAATGTAAAGAATGTGG + Exonic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1164045574 19:21536819-21536841 CCCTACAAATGTAAAGAATGTGG + Exonic
1164045590 19:21536987-21537009 CCCTACAAATGTAAAGAATGTGG + Exonic
1164067183 19:21726840-21726862 CCCTACAAATGTGAGGAATGTGG - Exonic
1164075013 19:21807734-21807756 CCCTACAAATGTAAAGAATGTGG - Exonic
1164075060 19:21808322-21808344 CCCTACAAGTGTGAAGAATGTGG - Exonic
1164092605 19:21972518-21972540 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092648 19:21973022-21973044 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092657 19:21973106-21973128 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092736 19:21973994-21974016 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092745 19:21974078-21974100 CCCTACAAATGTAAAGAATGTGG - Exonic
1164104033 19:22088777-22088799 CCCTTCCAATGTGAAGAGTGTGG + Exonic
1164112417 19:22180437-22180459 CCCTACAAGTGTGAAGAATGTGG - Exonic
1164112448 19:22180773-22180795 CCCTACAAGTGTGAAGAATGTGG - Exonic
1164125794 19:22315800-22315822 CCCTACAAGTGTGAAGAATGTGG + Exonic
1164125866 19:22316724-22316746 CCCTACCAATGTGACGAATGTGG + Exonic
1164125922 19:22317389-22317411 CCCTACAAATGTAAAGAATGTGG + Intergenic
1164133758 19:22391664-22391686 CCCTACAAGTGTGAAGAATGCGG - Exonic
1164133789 19:22392084-22392106 CCCTACAAGTGTGAAGAATGTGG - Exonic
1164133837 19:22392588-22392610 CCCTACAAATGTAAAGAATGTGG - Exonic
1164141539 19:22471245-22471267 CCTTTCAAATGTAAAGAATGTGG + Intronic
1164164972 19:22664171-22664193 CCCTACAAATGTAAAGAATGTGG + Exonic
1164165018 19:22664675-22664697 CCCTACAAGTGTGAAGAATGTGG + Exonic
1164165049 19:22665095-22665117 CCCTACAAGTGTGAAGAATGTGG + Exonic
1164166773 19:22685557-22685579 CCCTACAAATGTAAAGAATGTGG + Intergenic
1164166865 19:22686565-22686587 CCCTACAAGTGTGAAGAATGTGG + Intergenic
1164174297 19:22755767-22755789 CCCTTCAAATGTGAGGAATGTGG - Intergenic
1164184954 19:22857741-22857763 CCCTACAAATGTAAAGAATGTGG + Intergenic
1164215775 19:23145558-23145580 CCTTTCAAATGTAAAGAATGTGG + Exonic
1164215787 19:23145807-23145829 CCCTACCAATGTGAGAAATGTGG + Exonic
1164223703 19:23222458-23222480 CCCTACAAATGTAAAGAATGTGG - Exonic
1164223723 19:23222710-23222732 CCCTACAAATGTAAAGAATGTGG - Exonic
1164223738 19:23222878-23222900 CCCTACAAATGTAAAGAATGTGG - Exonic
1164223798 19:23223718-23223740 CCTTTCAAATGTAAAGAATGTGG - Exonic
1164238473 19:23360484-23360506 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238489 19:23360652-23360674 CCCTTCAAATGTAAAGAATGTGG - Exonic
1164238507 19:23360988-23361010 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238530 19:23361324-23361346 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238552 19:23361576-23361598 CCCTTCAAATGTAAAGAATGTGG - Exonic
1164238570 19:23361912-23361934 CCCTACAAATGTAAAGAATGTGG - Exonic
1164252430 19:23492213-23492235 CCCTACCAATGTGAAGAATGTGG - Intergenic
1164269031 19:23653476-23653498 CCCTACAAGTGTGAAGAATGTGG - Exonic
1164269050 19:23653728-23653750 CCCTACAAATGTAAAGAATGTGG - Exonic
1164269058 19:23653812-23653834 CCCTACAAATGTGAGGAATGCGG - Exonic
1164269096 19:23654400-23654422 CCTTTCAAATGTAAAGAATGTGG - Exonic
1164278262 19:23743847-23743869 CCCTACCAATGTGAAGAATGTGG - Exonic
1164278295 19:23744267-23744289 CCCTACCAGTGTGAAAAATGTGG - Exonic
1164287540 19:23832966-23832988 CCCTACAAGTGTGAAGAATGTGG + Intergenic
1164287547 19:23833050-23833072 CCCTACAAGTGTGAAGAATGTGG + Intergenic
1164319311 19:24126961-24126983 CCCTACAAGTGTGAAGAATGTGG + Exonic
1164395672 19:27861084-27861106 CTCTTCCAGTAGAATGAATGAGG - Intergenic
1164709822 19:30347782-30347804 CCCTTGCAGTGTCAGGAAAGGGG - Intronic
1165276723 19:34759515-34759537 CCCTTTGAGTGCAAAGAATGTGG - Exonic
1165297990 19:34943993-34944015 CCTTTTGAATGTAAGGAATGTGG + Exonic
1165298020 19:34944245-34944267 CCCTATGAATGTAAGGAATGTGG + Exonic
1165298030 19:34944329-34944351 CCCTATGAGTGTAAGGAATGTGG + Exonic
1165298037 19:34944413-34944435 CCCTATGAATGTAAGGAATGTGG + Exonic
1165298045 19:34944497-34944519 CCCTATGAGTGTAAGGAGTGTGG + Exonic
1165298064 19:34944665-34944687 CCTTTTGAATGTAAGGAATGCGG + Exonic
1165299330 19:34958572-34958594 CCTTACAAGTGTAACGAATGTGG - Exonic
1165500160 19:36182692-36182714 CCCTACGAATGTAAGGAATGTGG - Exonic
1165500177 19:36182860-36182882 CCCTATGAGTGTAAGGAATGTGG - Exonic
1165500186 19:36182944-36182966 CCCTACGAGTGTAAGGAATGCGG - Exonic
1165500195 19:36183028-36183050 CCCTATGAGTGTAAAGAATGCGG - Exonic
1165500233 19:36183364-36183386 CCCTTTGGATGTAAGGAATGTGG - Exonic
1165524323 19:36340705-36340727 CCCTACGAATGTAAGGAATGTGG - Exonic
1165524353 19:36341041-36341063 CCCTATGAATGTAAGGAATGTGG - Exonic
1165524371 19:36341209-36341231 CCTTATAAGTGTAAGGAATGTGG - Exonic
1165530217 19:36393057-36393079 CCCTATGACTGTAAGGAATGCGG - Exonic
1165530231 19:36393225-36393247 CCCTATGAATGTAAGGAATGTGG - Exonic
1165530240 19:36393309-36393331 CCCTATGAATGTAAGGAATGCGG - Exonic
1165530286 19:36393813-36393835 CCCTATGAATGTAAGGAATGTGG - Exonic
1165536294 19:36449284-36449306 CCCTATGAATGTAAGGAATGTGG - Exonic
1165536311 19:36449452-36449474 CCCTATGAATGTAAGGAATGTGG - Exonic
1165536319 19:36449536-36449558 CCCTTTGAATGTAAGGAATGTGG - Exonic
1165543623 19:36514394-36514416 CCCTACAAATGTAATGAATGTGG - Exonic
1165556654 19:36638837-36638859 CCCTATGAATGTAAGGAATGTGG - Exonic
1165556667 19:36639005-36639027 CCCTATGAGTGTAAGGAATGTGG - Exonic
1165567966 19:36748332-36748354 CCCTATGATTGTAAGGAATGTGG - Exonic
1165567973 19:36748416-36748438 CCCTATCATTGTAAGGAATGTGG - Exonic
1165567994 19:36748752-36748774 CCCTATGATTGTAAGGAATGTGG - Exonic
1165568039 19:36749256-36749278 CCCTATCACTGTAAGGAATGTGG - Exonic
1165568052 19:36749424-36749446 CCCTATCATTGTAAGGAATGTGG - Exonic
1165568089 19:36749844-36749866 CCCTATGATTGTAAGGAATGTGG - Exonic
1165568094 19:36749928-36749950 CCCTATGACTGTAAGGAATGTGG - Exonic
1165568106 19:36750096-36750118 CCCTATCATTGTAAGCAATGTGG - Exonic
1165582274 19:36877263-36877285 CCCTATGAGTGTAAGGAATGTGG + Exonic
1165582284 19:36877347-36877369 CCTTATGAGTGTAAGGAATGTGG + Exonic
1165582340 19:36877935-36877957 CCCTATGAATGTAAGGAATGTGG + Exonic
1165583536 19:36891550-36891572 CCCTATGACTGTAAGGAATGTGG - Exonic
1165583572 19:36892054-36892076 CCCTATGAATGTAAGGAATGTGG - Exonic
1165583579 19:36892138-36892160 CCCTATGAATGTAAGGAATGTGG - Exonic
1165589055 19:36950150-36950172 CCCTATGAATGTAAGGAATGTGG + Exonic
1165589082 19:36950486-36950508 CCCTATGAATGTAAGGAATGTGG + Exonic
1165589105 19:36950822-36950844 CCATTCAAATGTAATGAATGTGG + Exonic
1165589119 19:36950990-36951012 CCCTTTGAATGTAATGAATGTGG + Exonic
1165594086 19:36997291-36997313 CCCTGTAAGTGTAAGGAATGTGG + Intronic
1165594104 19:36997459-36997481 CCCCATAAGTGTAAGGAATGTGG + Intronic
1165594113 19:36997543-36997565 CCCTACGAGTGTAAGGAGTGTGG + Intronic
1165608356 19:37127403-37127425 CCCTATAAATGTAAGGAATGTGG + Exonic
1165608398 19:37127907-37127929 CCCTATGAATGTAAGGAATGTGG + Exonic
1165608427 19:37128159-37128181 CCCTATGAATGTAAGGAATGTGG + Exonic
1165608433 19:37128243-37128265 CCCTATCAATGTAAGGAATGTGG + Exonic
1165608448 19:37128411-37128433 CCCTATGAATGTAAGGAATGTGG + Exonic
1165608471 19:37128663-37128685 CCATATCAATGTAAGGAATGTGG + Exonic
1165608493 19:37128915-37128937 CCATATCAATGTAAGGAATGTGG + Exonic
1165620516 19:37242909-37242931 CCCTTTGAATGTAAGGAATGTGG + Exonic
1165620526 19:37242993-37243015 CCCTATGAATGTAAGGAATGTGG + Exonic
1165620540 19:37243161-37243183 CCCTATGAATGTAAGGAATGTGG + Exonic
1165620548 19:37243245-37243267 CCCTATGAGTGCAAGGAATGTGG + Exonic
1165620555 19:37243329-37243351 CCCTATGATTGTAAGGAATGTGG + Exonic
1165620574 19:37243581-37243603 CCCTATAACTGTAAGGAATGTGG + Exonic
1165641265 19:37389370-37389392 CCCTTCAAATGTAGTGAATGTGG + Exonic
1165650547 19:37484775-37484797 CCCTATGAATGTAAGGAATGTGG + Exonic
1165659564 19:37564737-37564759 CCCTATGAATGTAAGGAATGTGG - Exonic
1165659590 19:37565070-37565092 CCCTTTGAATGTAAGGAATGTGG - Exonic
1165659598 19:37565154-37565176 CCCTACAAATGTAAGGAATGTGG - Exonic
1165659630 19:37565490-37565512 CCTTATGAGTGTAAGGAATGTGG - Exonic
1165664184 19:37612340-37612362 CCCTACGAATGTAAGGAATGTGG + Exonic
1165664212 19:37612676-37612698 CCCTACGAATGTAAGGAATGTGG + Exonic
1165666560 19:37635126-37635148 CCCTATGACTGTAAGGAATGTGG - Exonic
1165669987 19:37668691-37668713 CCCTATGAGTTTAAGGAATGTGG - Exonic
1165670010 19:37669026-37669048 CCCTATCAGTGTAAAGAATGTGG - Exonic
1165670046 19:37669614-37669636 TCCTTTGAATGTAAGGAATGTGG - Exonic
1165673325 19:37698431-37698453 CCCTACGAATGTAAGGAATGTGG - Exonic
1165673356 19:37698767-37698789 CCCTTTGAATGTAAAGAATGTGG - Exonic
1165673366 19:37698851-37698873 CCCTACAAATGTAAGGAATGTGG - Exonic
1165673432 19:37699439-37699461 CCCTACGAATGTAAGGAATGTGG - Exonic
1165677413 19:37738811-37738833 CCTTTTGAATGTAAGGAATGTGG - Exonic
1165677424 19:37738979-37739001 CCCTATAAATGTAAGGAATGTGG - Exonic
1165684136 19:37803528-37803550 CCCTATGAATGTAAGGAATGTGG + Intronic
1165684146 19:37803612-37803634 CCCTACAAATGTAAAGAATGTGG + Intronic
1165684170 19:37803864-37803886 CCCTTTCAATGTAACAAATGTGG + Intronic
1166019596 19:40014168-40014190 CCCTACGAGTGTAAGGAATGTGG + Exonic
1166019626 19:40014504-40014526 CCCTACGAATGTAAAGAATGTGG + Exonic
1166019639 19:40014672-40014694 CCCTATGAATGTAAGGAATGTGG + Exonic
1166019649 19:40014756-40014778 CCCTATGAATGTAAGGAATGTGG + Exonic
1166019662 19:40014924-40014946 CCCTATGAATGTAAGGAATGTGG + Exonic
1166019687 19:40015260-40015282 CCCTACGAATGTACGGAATGTGG + Exonic
1166019718 19:40015680-40015702 CCCTATCAATGTAAAGAATGTGG + Exonic
1166021391 19:40033494-40033516 TCCTTTGAGTGTAAAGAATGTGG - Exonic
1166021420 19:40033997-40034019 CCCTGTGAGTGTAAAGAATGTGG - Exonic
1166021448 19:40034332-40034354 ACCTTTGAATGTAAGGAATGTGG - Exonic
1166021455 19:40034416-40034438 CCCTTTGAATGTAAGAAATGTGG - Exonic
1166021480 19:40034667-40034689 CCCTTTGAATGTAAAGAATGCGG - Exonic
1166021510 19:40035003-40035025 CCCTTTGAATGTAAGGAATGTGG - Exonic
1166021518 19:40035087-40035109 CCCTTTGAATGTAAGGAATGTGG - Exonic
1166021526 19:40035171-40035193 CCCTTTGAATGTAAGGAATGTGG - Exonic
1166021549 19:40035423-40035445 CCCTTTGAATGTAAAGAATGTGG - Exonic
1166024909 19:40073663-40073685 ATCTTTGAGTGTAAGGAATGTGG - Exonic
1166024949 19:40074250-40074272 CCCTTTGAATGTAAAGAATGTGG - Exonic
1166024981 19:40074586-40074608 CCCTTTGAATGTAAGGAATGTGG - Exonic
1166024988 19:40074670-40074692 CCCTTTGAATGTAAGGAGTGTGG - Exonic
1166024996 19:40074754-40074776 CCCTTTGAATGTAAGGAATGTGG - Exonic
1166025002 19:40074838-40074860 CCATTTGAATGTAAGGAATGTGG - Exonic
1166025042 19:40075258-40075280 CCGTTTGAATGTAAGGAATGTGG - Exonic
1166025059 19:40075426-40075448 CCCTTTGAATGTAAAGAATGTGG - Exonic
1166025068 19:40075510-40075532 CCCTTTGTATGTAAGGAATGTGG - Exonic
1166025097 19:40075846-40075868 CCCTTTGAATGTAAGGAGTGTGG - Exonic
1166563908 19:43751704-43751726 TCCTCCCAGTGACAGGAATGTGG + Intronic
1166576682 19:43847385-43847407 CCCTATGAGTGTAAGGAATGTGG + Exonic
1166576745 19:43847973-43847995 CCTTTTGAATGTAAGGAATGTGG + Exonic
1166576764 19:43848141-43848163 CCCTATGAATGTAAGGAATGTGG + Exonic
1166576785 19:43848309-43848331 CCTTTCAAATGTAAGGAATGTGG + Exonic
1166578785 19:43872880-43872902 CCCTATGAATGTAAGGAATGTGG - Exonic
1166578823 19:43873384-43873406 CCCTACAAATGTAAAGAATGTGG - Exonic
1166578829 19:43873468-43873490 CCCTTTGAATGTAAGGAATGTGG - Exonic
1166587839 19:43966931-43966953 CCCTATAATTGTAAGGAATGTGG + Exonic
1166587869 19:43967183-43967205 CCCTATAATTGTAAGGAATGTGG + Exonic
1166592379 19:44011294-44011316 CCCTTCAAATGTGAGGATTGTGG + Exonic
1166602314 19:44107775-44107797 CCATACAATTGTAAGGAATGTGG + Exonic
1166604847 19:44131977-44131999 CCCTATAATTGTAAGGAATGTGG + Exonic
1166619646 19:44284689-44284711 GCCTTACAGTGTGAGGACTGAGG - Intronic
1166623558 19:44328247-44328269 CCATTCAAATGTGAGGAATGTGG - Exonic
1166628771 19:44386608-44386630 CCCTATAAGTGTAAGGCATGTGG - Exonic
1166628846 19:44387280-44387302 CCCTACAAATGTAAAGAATGTGG - Exonic
1166638397 19:44472401-44472423 CCCTACAAATGTAAAGAATGTGG + Intergenic
1166638469 19:44473070-44473092 CCCTATAAGTGTAAGGCATGTGG + Intergenic
1167536843 19:50059110-50059132 CCCTATAAGTGTAAGGAATGTGG - Intergenic
1167835581 19:52065990-52066012 CCTTTCCAGTGTAACGAATGCGG - Exonic
1167835617 19:52066410-52066432 CCCTACAAATGTAATGAATGTGG - Exonic
1167835639 19:52066662-52066684 CCCTACAAATGTAATGAATGTGG - Exonic
1167840697 19:52116172-52116194 CCCTTCAAATGTAATGAGTGTGG - Exonic
1167845060 19:52155752-52155774 CCGTTTCAATGTAACGAATGCGG - Exonic
1167845073 19:52155920-52155942 CCTTTCCAATGTAATGAATGTGG - Exonic
1167870576 19:52366489-52366511 CCCTACAAATGTAACGAATGTGG + Exonic
1167872545 19:52384547-52384569 CCTTACAAATGTAAGGAATGTGG + Exonic
1167887256 19:52511237-52511259 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887263 19:52511321-52511343 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887271 19:52511405-52511427 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887285 19:52511573-52511595 CCTTACAAGTGTAATGAATGTGG + Exonic
1167887303 19:52511909-52511931 CCTTACAAGTGTAATGAATGTGG + Exonic
1167892672 19:52553940-52553962 CCTTACAAGTGTAATGAATGTGG + Exonic
1167892717 19:52554612-52554634 CCTTACAAGTGTAATGAATGTGG + Exonic
1167892766 19:52555368-52555390 CCTTACAAGTGTAATGAATGTGG + Exonic
1167896095 19:52582948-52582970 CCTTACAAGTGTAATGAATGTGG + Exonic
1167896119 19:52583368-52583390 CCTTACAAGTGTAATGAATGTGG + Exonic
1167897891 19:52596111-52596133 CCTTTCCAATGTAATGAGTGTGG + Intronic
1167899975 19:52613177-52613199 CCTTTCAAATGTAATGAATGTGG - Exonic
1167905082 19:52653044-52653066 CCTTACAAGTGTAATGAATGTGG - Intronic
1167905146 19:52653884-52653906 CCTTTCCAATGTAATGAGTGTGG - Intronic
1167911365 19:52705004-52705026 CCTTACAAGTGTAATGAATGTGG - Exonic
1167911408 19:52705592-52705614 CCTTACAAGTGTAATGAATGTGG - Exonic
1167918958 19:52765909-52765931 CCTTACAAGTGTAATGAATGTGG - Exonic
1167919003 19:52766497-52766519 CCTTACAAGTGTAATGAATGTGG - Exonic
1167923060 19:52799167-52799189 CCCTACAAGTGTAATGAATGTGG - Exonic
1167923104 19:52799839-52799861 CCTTACAAGTGTAATGAATGTGG - Exonic
1167923155 19:52800511-52800533 CCTTACAAGTGTAATGAATGTGG - Exonic
1167923172 19:52800763-52800785 CCTTACAAGTGTAATGAATGTGG - Exonic
1167932797 19:52881206-52881228 CCCTATAAGTGTAATGAATGTGG - Exonic
1167935808 19:52906571-52906593 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167935831 19:52906991-52907013 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167935852 19:52907327-52907349 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167938746 19:52928558-52928580 CCTTGCAAGTGTAATGAATGTGG - Exonic
1167941542 19:52949979-52950001 CCTTACAAGTGTAATGAATGTGG - Exonic
1167943722 19:52969675-52969697 CCTTACAAGTGTAATGAATGTGG - Intergenic
1167956458 19:53068822-53068844 CCTTACAAGTGTAATGAATGTGG - Exonic
1167956486 19:53069158-53069180 CCTTACAAGTGTAATGAATGTGG - Exonic
1167956506 19:53069410-53069432 CCGTTCAAATGTAATGAATGTGG - Exonic
1167961563 19:53108876-53108898 CCATACAAGTGTAATGAATGTGG - Exonic
1167965380 19:53140768-53140790 CCTTACCAGTGTAATGAATGTGG - Exonic
1167968164 19:53165603-53165625 CCTTACAAATGTAAGGAATGTGG - Exonic
1167990094 19:53352323-53352345 CCTTACCAGTGTAATGAGTGTGG + Exonic
1167990152 19:53353079-53353101 CCTTACAAGTGTAATGAATGTGG + Exonic
1167990183 19:53353499-53353521 CCTTACAAGTGTAATGAATGTGG + Exonic
1167993584 19:53382979-53383001 CCTTACAAGTGTAATGAATGTGG + Exonic
1168002108 19:53456152-53456174 CCTTACAAGTGTAAGGAGTGTGG + Exonic
1168002174 19:53457068-53457090 CCTTACCAGTGTAATGAGTGTGG + Exonic
1168006313 19:53491208-53491230 CCATACAAGTGTAATGAATGTGG + Exonic
1168006320 19:53491292-53491314 CCTTTCAAGTGTAATGAGTGTGG + Exonic
1168006338 19:53491460-53491482 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006355 19:53491712-53491734 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006362 19:53491796-53491818 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006367 19:53491880-53491902 CCTTACAAGTGTAATGAATGTGG + Exonic
1168006373 19:53491964-53491986 CCTTACAAGTGTAATGAATGTGG + Exonic
1168442696 19:56384215-56384237 CCCTACCAATGTAAGGTATGTGG - Exonic
1168442725 19:56384551-56384573 CCCTATCAGTGTAAGGAATGTGG - Exonic
1168442745 19:56384803-56384825 CCCTATAAATGTAAGGAATGTGG - Exonic
1168448217 19:56441565-56441587 CCCTACCAGTGTGAGGAATGTGG - Exonic
1168448228 19:56441733-56441755 CTATTTGAGTGTAAGGAATGTGG - Exonic
1168463135 19:56578455-56578477 CCCTATGAGTGTAAAGAATGTGG + Exonic
1168531736 19:57135399-57135421 CCCTTTCAATGTACGGACTGTGG - Exonic
1168531751 19:57135567-57135589 CCCTATCAGTGTAAGACATGTGG - Exonic
1168618744 19:57859631-57859653 CCCTATGAGTGCAAGGAATGTGG + Exonic
1168624765 19:57909037-57909059 CCCTATGAGTGCAAGGAATGTGG - Exonic
1168644924 19:58053695-58053717 CCCTTCCAGTGTGCCGACTGTGG + Exonic
1168644995 19:58053959-58053981 CCCTTCCAGTGTAGCGTCTGCGG + Exonic
1168647174 19:58067121-58067143 CCCTACAAATGTCAGGAATGCGG + Exonic
1168667183 19:58212949-58212971 CCCTACAAGTGTCAGGACTGTGG + Exonic
1168684328 19:58338817-58338839 CCCCATGAGTGTAAGGAATGTGG + Exonic
1202664095 1_KI270708v1_random:101194-101216 CCCTATCAGTGTAGTGAATGTGG + Intergenic
927053788 2:19352366-19352388 CCCTTCAAGTGTCAAGAGTGTGG - Exonic
930731878 2:54735736-54735758 CCCTTTCAATGTAAGAAATGTGG + Intronic
931282730 2:60808232-60808254 GCCTTCCAGTCCAAGGAAGGTGG - Intergenic
932172545 2:69570526-69570548 TCCTACCAGTGTAAGGATTTTGG + Intronic
932357995 2:71082410-71082432 CCCTTCCATTTTTAGGAAGGAGG + Intergenic
934537705 2:95149604-95149626 CCCTACAAATGTAATGAATGTGG - Exonic
934541821 2:95181594-95181616 CCCTTTCAGTGCAACGAGTGTGG + Exonic
934545859 2:95215448-95215470 CCCTACAAGTGTAAGGAATGTGG + Exonic
936343063 2:111654607-111654629 ACCTTCCAGGGAAAGGAATATGG + Intergenic
936621993 2:114109577-114109599 CCCTTCCTGTGCAAGGAACTTGG + Intergenic
936742578 2:115531350-115531372 CTCTTGCAGTTTAAGGAATCAGG - Intronic
937168102 2:119839918-119839940 TCCTTCCAGTGGAAAGTATGAGG + Intronic
938523752 2:132102580-132102602 CCTTTCAAATGTAAAGAATGTGG + Intergenic
938544772 2:132317906-132317928 CCCTACAAATGTAAAGAATGTGG + Intergenic
938544848 2:132318578-132318600 CCCTGTAAGTGTAAGGCATGTGG + Intergenic
938630904 2:133166075-133166097 GCCCTGCAGTGGAAGGAATGGGG + Intronic
944886341 2:204066198-204066220 CTCTATCATTGTAAGGAATGTGG + Intergenic
945500799 2:210571967-210571989 CCCTTACAGTTTTAGGACTGAGG - Intronic
945692113 2:213049850-213049872 CCCTTCCACTGTAACCAGTGTGG - Exonic
947115222 2:226762877-226762899 CCTTTCCAATGGAAGGAATCAGG + Intronic
1170616645 20:17958173-17958195 TCCTTACAGTAAAAGGAATGGGG - Intronic
1171873707 20:30551312-30551334 CCCTATAAGTGTAAGGCATGTGG + Intergenic
1172289011 20:33761878-33761900 CCCTTCCAGTGCATTGCATGTGG + Exonic
1173890168 20:46501606-46501628 CCCTATGAGTGTAATGAATGTGG - Exonic
1174208453 20:48858068-48858090 CCCGGCCACTGTAAGAAATGTGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1176772878 21:13098019-13098041 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1179117495 21:38507449-38507471 CCCTCCCAGTGTCAGCACTGGGG - Intronic
1180330822 22:11478078-11478100 CCCTATCAGTGTAGTGAATGTGG + Intergenic
1180437662 22:15327365-15327387 CCCTACCAATGTGAAGAATGTGG - Intergenic
1180437667 22:15327449-15327471 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1180520511 22:16197652-16197674 CCCTACCAATGTGAAGAATGTGG - Intergenic
1180520517 22:16197736-16197758 CCTTTCAAATGTAAAGAATGTGG - Intergenic
1181079826 22:20406444-20406466 CCCTTCAAGTGCAACGAGTGCGG + Exonic
1181566904 22:23744368-23744390 CCTTATCAGTGTAAGGAATGTGG - Exonic
1181566914 22:23744452-23744474 CCCTACGAGTGCAGGGAATGCGG - Exonic
1183096622 22:35555848-35555870 CCATTCCAGGGCAAGGACTGTGG - Intergenic
949904639 3:8848787-8848809 CTCTTCCAGTGGGAGGACTGGGG - Intronic
951069243 3:18306969-18306991 CTCTTCCATTGAAAGAAATGTGG - Intronic
952288331 3:31989932-31989954 CCTTACAAGTGTAATGAATGTGG + Exonic
952288377 3:31990604-31990626 CCTTACAAGTGTAATGAATGTGG + Exonic
952836720 3:37608912-37608934 AGCTTCCAGTGCAAGGAATCTGG - Intronic
953168609 3:40487453-40487475 CCCTTTAAATGTAAGGAATGTGG + Exonic
953172132 3:40516681-40516703 CCCTTTGAATGTAAGGAGTGTGG + Exonic
953173951 3:40532302-40532324 CCCTTTAAGTGTAAGGAGTGTGG + Exonic
953440756 3:42914896-42914918 CCCTTTGAATGTAAGGAATGTGG + Exonic
953628888 3:44594422-44594444 CCCTATAAGTGTAAGGAGTGTGG + Exonic
953633647 3:44642823-44642845 CCTTACAAGTGTAAAGAATGTGG + Exonic
953638471 3:44683959-44683981 CCATTTGAGTGTAATGAATGCGG - Intergenic
953638507 3:44684211-44684233 CCTTTCCTATGTAATGAATGCGG - Intergenic
953643831 3:44734902-44734924 CCTTTTAAGTGTAATGAATGTGG + Exonic
954845034 3:53547944-53547966 CCTTTCCAGCGTGAGCAATGGGG + Intronic
955959496 3:64325439-64325461 CCATTCTAGTGTATGGAAAGTGG - Intronic
957091857 3:75738421-75738443 CCCTATCAGTGTAGTGAATGTGG - Intronic
959279198 3:104316640-104316662 CTCTTCAAGTGGAAGGAAGGGGG - Intergenic
959308672 3:104701757-104701779 ACATTCCATTGTAAGGTATGTGG + Intergenic
960149483 3:114236407-114236429 CCCTACGAGTGCAAAGAATGTGG - Exonic
960763621 3:121099728-121099750 CCCTGCAAATTTAAGGAATGTGG + Intronic
966439426 3:179927362-179927384 TCCTGCCAGTGTAAGGAGAGAGG + Intronic
968380065 4:86351-86373 CCCTACAAATGTAAAGAATGTGG + Exonic
968380073 4:86435-86457 CCCTACAAATGTAAAGAATGTGG + Exonic
968380122 4:87023-87045 CCCTACAAATGTAAAGAATGTGG + Exonic
968388039 4:162033-162055 CCCTACAAATGTAAAGAATGCGG + Exonic
968397379 4:254678-254700 CCCTACAAATGTAAAGAATGTGG + Intergenic
968398926 4:270916-270938 CCCTACAAATGTAAAGAATGTGG - Exonic
968416573 4:441686-441708 CCATACAAGTGTAAAGAATGTGG - Exonic
968416606 4:442107-442129 CCCTACAAATGTAAGGAATGTGG - Exonic
968416690 4:443031-443053 CCCTACAAATGTAAGCAATGTGG - Exonic
968416698 4:443115-443137 CCCTACAAATGTAAAGAATGTGG - Exonic
968416752 4:443703-443725 CCCTACAAATGTAAGGAATGTGG - Exonic
968416761 4:443787-443809 CCCTACAAATGTAAAGAATGTGG - Exonic
973220154 4:47716929-47716951 ACTTTCCATTGTAATGAATGTGG - Intronic
973748045 4:53983981-53984003 CCATTCCAGTGCAGGGAAAGAGG - Intronic
973960648 4:56106546-56106568 CCCTTTCAGTGTTAGCTATGTGG + Intergenic
978723693 4:111945541-111945563 CCCTTCCAGTTAAAGAAATCAGG - Intergenic
982843739 4:160223978-160224000 CCCTTCCTGTGTAAAGATTCTGG - Intergenic
988406352 5:30827742-30827764 CCCTTCCTGTGTAGAGACTGTGG - Intergenic
990344451 5:54857621-54857643 CCCTACAAATGTAAGGAATGTGG + Intergenic
990344485 5:54858039-54858061 CCCTGTGAATGTAAGGAATGTGG + Intergenic
990344496 5:54858123-54858145 CCCTATCAGTGTAAGGAATGTGG + Intergenic
993154300 5:84202867-84202889 CCATTCCACTGGAAGAAATGAGG + Intronic
994876194 5:105424567-105424589 ATCTTGCAGTCTAAGGAATGAGG - Intergenic
997586259 5:135045348-135045370 ACCTTCCAGGGTAAGAAAAGTGG - Intronic
999325525 5:150641191-150641213 TCCTTTCAGTGGGAGGAATGGGG + Intronic
1000204397 5:159044555-159044577 CTCTTCCAGTGTAAGTCACGAGG + Intronic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1002393174 5:178931866-178931888 CCCTATCAGTGTAAAGAGTGTGG + Exonic
1002393181 5:178931950-178931972 CCCTACAAATGTAATGAATGTGG + Exonic
1002393232 5:178932622-178932644 CCCTATCAGTGTAATGAATGCGG + Exonic
1002396966 5:178965131-178965153 CCCTATGAATGTAAGGAATGTGG + Exonic
1002396996 5:178965467-178965489 CCCTTTGAATGTAATGAATGTGG + Exonic
1002406077 5:179032891-179032913 CCCTATAAGTGTAATGAATGTGG + Exonic
1002406096 5:179033059-179033081 CCCTTTCATTGTAACGAGTGTGG + Exonic
1002406108 5:179033227-179033249 CCCTACAAATGTAATGAATGTGG + Exonic
1002587471 5:180259116-180259138 CCCTTTGACTGTAAGGAATGTGG + Intronic
1002587477 5:180259200-180259222 CCCTTTGACTGTAAGGAATGTGG + Intronic
1002587484 5:180259284-180259306 CCCTTTGACTGTAAGGAATGTGG + Intronic
1002587498 5:180259452-180259474 CCCTTTGACTGTAAGGAATGTGG + Intronic
1002587506 5:180259536-180259558 CCCTTTGACTGTAAGGGATGTGG + Intronic
1002587512 5:180259620-180259642 CCCTTTGACTGTAAGGAATGTGG + Intronic
1002587520 5:180259704-180259726 CCCTTTGACTATAAGGAATGTGG + Intronic
1002669114 5:180850887-180850909 CCGTACAAGTGTGAGGAATGTGG - Exonic
1003088981 6:3085133-3085155 CCATTCCACTCTATGGAATGAGG + Intronic
1003839301 6:10103691-10103713 TCCTTTCTTTGTAAGGAATGAGG + Intronic
1005603535 6:27451868-27451890 CCCTATCAGTGTCATGAATGTGG - Exonic
1005669332 6:28089291-28089313 CCCTACGAGTGTAGTGAATGTGG + Exonic
1005672019 6:28115989-28116011 CCATACCAGTGTAATGATTGTGG + Intergenic
1005675851 6:28153913-28153935 CCCTACCAATGTAATGAGTGTGG + Exonic
1005688313 6:28277004-28277026 CCCTATCAGTGTAGTGAATGTGG + Exonic
1005693108 6:28326485-28326507 CCCTATCAATGTAAGGAGTGTGG - Exonic
1005699986 6:28390947-28390969 TGCTATCAGTGTAAGGAATGTGG - Exonic
1007162550 6:39803689-39803711 TCCTTCCAGTGTTAGCACTGAGG - Intronic
1007235901 6:40391379-40391401 CCCTTCCAGTGTCGGGTGTGGGG + Intergenic
1014492702 6:122082113-122082135 CCCTTCAAAGGCAAGGAATGGGG + Intergenic
1014799159 6:125758788-125758810 CACTTCCAGAGAAAGAAATGGGG - Intronic
1015650653 6:135455001-135455023 CCCTTCCAGTGTAAGCTAGATGG - Intronic
1016392775 6:143591771-143591793 CTCTCCCAGGGTAGGGAATGTGG + Intronic
1016510266 6:144834782-144834804 TCCTTCCTGTGTAAGCGATGGGG - Intronic
1016852756 6:148638162-148638184 CCCTTCCTGTTTTAGGAAGGAGG + Intergenic
1018314999 6:162548008-162548030 ACCTTCCAGTGTCAGGAGGGAGG - Intronic
1019347731 7:538952-538974 CCCTACCAGTCTGAGGGATGGGG - Intergenic
1023527101 7:41116307-41116329 CTCTGCCAGTGCAAGGACTGGGG + Intergenic
1024529795 7:50382548-50382570 CCCTTCCAGTGCAATCAGTGCGG + Exonic
1025141129 7:56466529-56466551 CCATACAAATGTAAGGAATGTGG + Intergenic
1025159249 7:56639327-56639349 CCCTACAAATGTAATGAATGTGG - Intergenic
1025159256 7:56639411-56639433 CCCTACAAATGTAATGAATGTGG - Intergenic
1025222091 7:57120423-57120445 CCCTGCAGGTGTGAGGAATGTGG - Exonic
1025612444 7:63087981-63088003 CCATACAAATGTAAGGAATGTGG - Intergenic
1025632871 7:63292095-63292117 CCCTGCAGGTGTGAGGAATGTGG - Intergenic
1025649826 7:63456088-63456110 CCCTGCAGGTGTGAGGAATGTGG + Intergenic
1025727254 7:64077980-64078002 CCCTACAAATGTAATGAATGTGG + Intronic
1025727340 7:64078899-64078921 CCCTACAAATGTAATGAATGTGG + Intronic
1025748284 7:64266684-64266706 CCCTACAAATGTAAAGAATGTGG + Exonic
1025748303 7:64266930-64266952 CACTACAAGTGTAAAGAATGTGG + Exonic
1025767505 7:64469459-64469481 CCCTTCAAATGTAAAGAATGTGG + Intergenic
1025767541 7:64469962-64469984 CCCTACAAATGTAAAGAATGTGG + Intergenic
1025772246 7:64521771-64521793 CCCTTCAAATGTGAAGAATGTGG - Exonic
1025772259 7:64521939-64521961 CCCTTCAAATGTGAAGAATGTGG - Exonic
1025772267 7:64522023-64522045 CCCTACAAATGTGAGGAATGTGG - Exonic
1025792800 7:64707031-64707053 CTCTACAAGTGTAAAGAATGTGG + Exonic
1025792807 7:64707115-64707137 CCCTACAAATGTAAAGAATGTGG + Exonic
1025792824 7:64707367-64707389 CCCTACAAATGTAAAGAATGTGG + Exonic
1025792928 7:64708789-64708811 ACCTTACAATGTAAAGAATGTGG + Exonic
1025805758 7:64832410-64832432 CCCTACAAATGTAAAGAATGTGG + Intronic
1025817398 7:64927941-64927963 CCTTTCAAATGTAAAGAATGTGG + Exonic
1025822256 7:64977547-64977569 CCCTACAAGTGTGAAGAATGTGG - Exonic
1025822261 7:64977631-64977653 CCCTACAAGTGTGAAGAATGTGG - Exonic
1025822327 7:64978555-64978577 CCCTACAAATGTGAGGAATGTGG - Exonic
1026407749 7:70085249-70085271 CCCTTCCAGAGCAAGGCATAAGG - Intronic
1027619927 7:80471703-80471725 GCCATACAGTGTAAGGAGTGTGG + Intronic
1028868424 7:95738691-95738713 CCCTTCCTGTGTAGAGATTGTGG + Intergenic
1029294780 7:99531455-99531477 CCATTCAGGTGTGAGGAATGTGG + Exonic
1029294802 7:99531623-99531645 CCCTTCAAGTGTAACGAATGTGG + Exonic
1029294850 7:99532127-99532149 CCTTTTCAATGTAAAGAATGTGG + Exonic
1029357652 7:100064354-100064376 CCTTATCAGTGTAACGAATGTGG + Exonic
1029358572 7:100071363-100071385 CCCTACGAATGTATGGAATGTGG - Exonic
1034176446 7:149103772-149103794 CCCTTCCAGTGTCCCGAGTGTGG - Exonic
1034203162 7:149294910-149294932 CCCTTCCAGTGCACGCAATGTGG + Intronic
1037383952 8:18317739-18317761 CCCTTGGAGTGGAATGAATGGGG - Intergenic
1040380930 8:46871331-46871353 CCCTACAAATGTAATGAATGTGG - Intergenic
1041218205 8:55622746-55622768 CCCTACAAATGTAAAGAATGTGG + Intergenic
1041367997 8:57129797-57129819 CCCTTCCAGGGTGAGGAAGTTGG - Intergenic
1045112975 8:98950678-98950700 CCCTTCAAATGTCAGGAGTGTGG + Exonic
1045314137 8:101028526-101028548 CTCTTCCAGTGAATAGAATGTGG + Intergenic
1047066956 8:121295148-121295170 CCTTACCAGTTTAAGGAGTGGGG + Intergenic
1047445362 8:124914502-124914524 CCCTTCCACTGGCAGAAATGAGG - Intergenic
1047452370 8:124976827-124976849 CCCTACCAGTGTGGTGAATGTGG + Exonic
1049630340 8:143651160-143651182 CCCTTCGAATGTAAAGACTGTGG + Exonic
1049834137 8:144722680-144722702 CCCTACAAGTGTAATGAATGTGG - Exonic
1049841210 8:144773759-144773781 CCATTTGAGTGCAAGGAATGTGG - Exonic
1049846976 8:144807526-144807548 CCCTTCCAGTGCACAGAGTGCGG + Exonic
1049858627 8:144881744-144881766 CCCTTCCAGTGCACAGAATGTGG - Exonic
1053077680 9:35148565-35148587 CCCTACAAATGTAAAGAATGTGG - Intergenic
1053584685 9:39444679-39444701 CCCTATGAGTGTAATGAATGCGG - Intergenic
1053584735 9:39445099-39445121 CCCTATGAGTGTAATGAATGTGG - Intergenic
1053702496 9:40710208-40710230 CCTTTCAAATGTAAAGAATGTGG + Intergenic
1054106265 9:61003425-61003447 CCCTATGAGTGTAATGAATGCGG - Intergenic
1054106315 9:61003845-61003867 CCCTATGAGTGTAATGAATGTGG - Intergenic
1054412555 9:64833671-64833693 CCTTTCAAATGTAAAGAATGTGG + Intergenic
1054581583 9:66920123-66920145 CCCTATGAGTGTAATGAATGTGG + Exonic
1054581633 9:66920543-66920565 CCCTATGAGTGTAATGAATGCGG + Exonic
1055732229 9:79289966-79289988 TCCTTCCAGGGAAAGGAAAGTGG + Intergenic
1057039236 9:91835422-91835444 CTTTTCCAGTATATGGAATGAGG - Intronic
1057610102 9:96534885-96534907 CTTTTCCAGTATAAGGAATCTGG + Intronic
1057635269 9:96758929-96758951 CCCTTTCAGTGTAATAAATGTGG - Exonic
1057635289 9:96759097-96759119 CCATTCAAATGTAACGAATGTGG - Exonic
1058145669 9:101408291-101408313 CCTTTTCAGTGCAATGAATGTGG + Exonic
1058380974 9:104376755-104376777 CCCCTCCTGTGTAAAGAAGGCGG + Intergenic
1058566028 9:106286413-106286435 CCCCTCCAGTGGAAGGAACAAGG - Intergenic
1058815635 9:108680485-108680507 CCCTTCCCGTGAAAGAACTGAGG + Intergenic
1059263023 9:112997280-112997302 CCCTACCAGTGTAATGAATGTGG - Intergenic
1059266967 9:113043218-113043240 CCCTTTGAATGTAATGAATGTGG - Exonic
1060807431 9:126586466-126586488 CCCTTCTGGTGTCAGGGATGAGG - Intergenic
1186715137 X:12243745-12243767 CTGCTCCAGTGTGAGGAATGTGG - Intronic
1190088009 X:47412722-47412744 CCCTTTGAATGTAATGAATGTGG + Exonic
1190088057 X:47413142-47413164 CCCTATCAGTGTAATGAATGTGG + Exonic
1190088086 X:47413478-47413500 CCCTTTGAGTGTCAAGAATGTGG + Exonic
1190577698 X:51857595-51857617 TCCTTTCAGTGTAATGAATATGG + Intronic
1191710540 X:64145871-64145893 CCCTATCAGTGTAAGAAATGTGG - Intergenic
1194535619 X:95103198-95103220 CCCTTGCAGGGTGAGCAATGGGG + Intergenic
1196138760 X:112237927-112237949 CTGTTCCAGTGTTAGGAAGGTGG + Intergenic
1196613690 X:117743193-117743215 CCCTTCCAGAGCAAAGACTGTGG + Intergenic
1197171250 X:123436845-123436867 GCCTTCCAGTTAAAGGAATGAGG + Intronic
1197360501 X:125496574-125496596 CCCATCCAGTGTAAAGATTGTGG - Intergenic
1198296026 X:135287558-135287580 CCTTTTAAGTGTCAGGAATGTGG - Exonic
1198642438 X:138771002-138771024 ACCCTACAGTGTAAAGAATGGGG + Intronic
1199163990 X:144648314-144648336 CCTCTCAAGTGTAAGGAAAGGGG + Intergenic
1200038303 X:153347223-153347245 CCCTTCGAGTGCGAGGAGTGCGG + Exonic