ID: 1139681202

View in Genome Browser
Species Human (GRCh38)
Location 16:68565210-68565232
Sequence TGGAAACCACTTCACATCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139681202_1139681209 23 Left 1139681202 16:68565210-68565232 CCAAAGATGTGAAGTGGTTTCCA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1139681209 16:68565256-68565278 TAAAGCTGGGTTAAAAATGCAGG 0: 1
1: 0
2: 0
3: 28
4: 212
1139681202_1139681206 9 Left 1139681202 16:68565210-68565232 CCAAAGATGTGAAGTGGTTTCCA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1139681202_1139681205 0 Left 1139681202 16:68565210-68565232 CCAAAGATGTGAAGTGGTTTCCA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1139681205 16:68565233-68565255 CAGTATGATACAGCCTATAAGGG 0: 1
1: 0
2: 0
3: 12
4: 132
1139681202_1139681204 -1 Left 1139681202 16:68565210-68565232 CCAAAGATGTGAAGTGGTTTCCA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1139681204 16:68565232-68565254 ACAGTATGATACAGCCTATAAGG 0: 1
1: 0
2: 1
3: 8
4: 84
1139681202_1139681207 10 Left 1139681202 16:68565210-68565232 CCAAAGATGTGAAGTGGTTTCCA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1139681207 16:68565243-68565265 CAGCCTATAAGGGTAAAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139681202 Original CRISPR TGGAAACCACTTCACATCTT TGG (reversed) Exonic
901473603 1:9474127-9474149 TGCAAAGCACTTCACATCACTGG - Intergenic
902705935 1:18204501-18204523 TGGCCACCAGTTCACCTCTTGGG + Intronic
904595641 1:31643562-31643584 GGGAAGCCACTTAACCTCTTTGG + Intronic
904605207 1:31694447-31694469 TGGTAACCTCTGCACATCTGGGG + Intronic
906110863 1:43321179-43321201 TGGGAGGCACTGCACATCTTGGG + Intronic
907149085 1:52265681-52265703 TAACAACCATTTCACATCTTTGG - Intronic
910818881 1:91324404-91324426 TGGCAACTACTTTACAACTTAGG - Intronic
914246160 1:145887070-145887092 TGTAAACCACTTAAGAACTTTGG - Intergenic
915936845 1:160094734-160094756 TGCAAATCACTTAACCTCTTTGG + Intronic
917070319 1:171143226-171143248 TGGAAAGCACATCATTTCTTTGG - Exonic
921676369 1:217980884-217980906 TGGAACCCTCCTCTCATCTTGGG - Intergenic
922151844 1:223012912-223012934 CAGAAACCACTGCAGATCTTGGG - Intergenic
1065540885 10:26765796-26765818 AGGAAACCATTTCAAATATTAGG - Intronic
1066179801 10:32949678-32949700 TGGAAACAATTGCACATATTTGG - Intronic
1066231036 10:33433318-33433340 TAGGAACCACTTAACATCCTTGG - Intergenic
1066455862 10:35571369-35571391 TGGAATCCACTTTAAATTTTAGG - Exonic
1069548582 10:69346314-69346336 TGGAAATCACATCACCACTTAGG - Intronic
1070229048 10:74544288-74544310 TGGTGACCACTTCCCATCCTGGG + Intronic
1071846288 10:89524446-89524468 TTGAAAGCACTGCTCATCTTCGG - Intronic
1072560399 10:96567855-96567877 AGGAAATCACTACACATATTAGG + Intronic
1074102003 10:110361039-110361061 TGGAAACGACTTCAGAACCTTGG + Intergenic
1074198315 10:111208465-111208487 AGGAAACCACTTCACCTCTCTGG - Intergenic
1074680645 10:115903761-115903783 TGCAAACCACTTCACAACATAGG - Intronic
1074966992 10:118500081-118500103 GGGAAATCACTTCACATTTGGGG - Intergenic
1075261665 10:120968583-120968605 AGAAAGTCACTTCACATCTTTGG + Intergenic
1076154741 10:128195023-128195045 AAGAAAACACTTCACATATTTGG - Intergenic
1076367553 10:129931923-129931945 TGAAAACATCTGCACATCTTGGG - Intronic
1080201863 11:29680995-29681017 TGCAAATCACTTGACATCTCTGG - Intergenic
1081007315 11:37761616-37761638 TGGAAACCATTTGAAATCCTTGG + Intergenic
1082214497 11:49551750-49551772 TGCTAACAACTTCACCTCTTTGG + Intergenic
1086259659 11:84923764-84923786 AGGAACCCAGTTCACATTTTAGG - Intronic
1086635094 11:89072739-89072761 TGCTAACAACTTCACCTCTTTGG - Intergenic
1087259230 11:95992253-95992275 TGGAAAGGACTTCACTTCTCAGG + Intronic
1088723042 11:112611387-112611409 TGGAAACCAAATCAAATCTTGGG - Intergenic
1088818604 11:113438067-113438089 TGCATACCACTCCACATCCTGGG + Intronic
1093106212 12:15090691-15090713 GGGAAACCACTGCACATTCTAGG + Intergenic
1093361862 12:18238548-18238570 TGGGAACCACATAGCATCTTAGG + Intronic
1095703856 12:45216926-45216948 TGGAAACCCTTTCCCATCTGCGG + Intronic
1095856778 12:46868653-46868675 TGAAAACCACTTCACTCCATAGG + Intergenic
1101211975 12:102543726-102543748 TGGCATTCACTTCACATCTCTGG + Intergenic
1102710364 12:114920864-114920886 TGGAAACCACCTCACTGCTTTGG + Intergenic
1104514106 12:129407926-129407948 TGGAAACCACTGTCCATCTGTGG - Intronic
1105610611 13:21966303-21966325 TGGAAGCCACATGCCATCTTTGG - Intergenic
1106985971 13:35350545-35350567 TGGAAACCTCTTATCACCTTGGG - Intronic
1108187717 13:47904868-47904890 TAGAAACCGCTTCACACCATTGG + Intergenic
1108625609 13:52225638-52225660 TCGAAGCCAGTTAACATCTTTGG - Intergenic
1108660454 13:52580781-52580803 TCGAAGCCAGTTAACATCTTTGG + Intergenic
1110034921 13:70671734-70671756 TTTAAACCACTTGCCATCTTTGG - Intergenic
1110399135 13:75069174-75069196 TGGTAACCACCTCACATCACTGG + Intergenic
1110957098 13:81567629-81567651 TGGAAACAAATTCACCTCCTAGG - Intergenic
1111469694 13:88662946-88662968 GGGAAAACACTTCATTTCTTTGG + Intergenic
1112655376 13:101446861-101446883 TGGAAACCAAGGAACATCTTGGG - Intergenic
1118507026 14:66424736-66424758 TGGAACCCTTTTAACATCTTTGG + Intergenic
1118829211 14:69413841-69413863 GGCAAATCACTTCTCATCTTTGG + Intronic
1119598563 14:75958788-75958810 TGGAAGACACTTCAGATCTGAGG - Exonic
1120243372 14:81976257-81976279 TGCAAATCACTTCATCTCTTAGG + Intergenic
1122075152 14:99231031-99231053 TGGATAACACTTAACATCTGAGG - Intronic
1123832080 15:24149834-24149856 TGGTAACATCATCACATCTTTGG + Intergenic
1126388025 15:48113908-48113930 GGAAAATCACTTCACTTCTTAGG - Intergenic
1126967222 15:54068293-54068315 TGGCAAACACTTCACAACTTTGG - Intronic
1127683966 15:61323695-61323717 AGGAAACCACTTCACATTTATGG - Intergenic
1130094905 15:80848666-80848688 TGGGAACCCCTTCTCATCTATGG - Intronic
1130190343 15:81729090-81729112 TGCCCACCTCTTCACATCTTGGG + Intergenic
1131145000 15:90005082-90005104 TGGAAATCAGTTCAGGTCTTGGG - Intronic
1131566375 15:93489336-93489358 GGGAAACTTCTTCACATATTTGG + Intergenic
1133127807 16:3657548-3657570 TGGAAACCACATGACAGCCTAGG - Intronic
1137329548 16:47478373-47478395 TAGAAACCCCTTCATATTTTGGG + Intronic
1139681202 16:68565210-68565232 TGGAAACCACTTCACATCTTTGG - Exonic
1140052368 16:71493476-71493498 AGGTAACCACTTCAAATTTTAGG - Intronic
1140538485 16:75733144-75733166 AGGAAACCACTTCATCTTTTGGG - Intronic
1145290494 17:21541805-21541827 TATAAAGCACTTCACATGTTTGG - Intronic
1146640364 17:34536160-34536182 GGGAAACAACTCCCCATCTTTGG - Intergenic
1147945265 17:44077164-44077186 TAGGAGCCACTTCCCATCTTTGG + Exonic
1148815008 17:50321325-50321347 CGAAAACCACATCACATCCTGGG + Intergenic
1155900012 18:31377628-31377650 TGGAAATCATGTCACACCTTGGG - Intronic
1156442713 18:37207678-37207700 GTGAGGCCACTTCACATCTTAGG + Intronic
1158202654 18:54958161-54958183 TGAAAACAACTACACTTCTTGGG - Intronic
1160594227 18:79963241-79963263 TGGAAACTGCTTCACTTCTGAGG + Intergenic
1164968272 19:32506763-32506785 TGGAAAGCCCTTCAAATATTTGG + Intergenic
925862865 2:8197332-8197354 TGGAAATCACTGCTCATCCTGGG + Intergenic
926178458 2:10617997-10618019 TGGCAACCACTGCACAACTCTGG + Intronic
926418280 2:12672656-12672678 TAGAAACCACTTCCCACCTCAGG + Intergenic
929276350 2:40029338-40029360 GGCAGCCCACTTCACATCTTGGG + Intergenic
930993783 2:57691544-57691566 GAGATACCATTTCACATCTTTGG + Intergenic
931622254 2:64222596-64222618 TGGAAATTAGGTCACATCTTAGG - Intergenic
936144590 2:109971597-109971619 TGGAAAGCCCTTCAGATCTATGG - Intergenic
937307355 2:120880541-120880563 GGGAAACCAGGTCACATCTGTGG + Intronic
942155238 2:173121265-173121287 AGGAAACCACTTCACAGCAAGGG - Intronic
942359435 2:175156577-175156599 TGGAAAGCACTTCAGCTCCTGGG + Intronic
943774351 2:191749276-191749298 AGGAAACATCCTCACATCTTAGG - Intergenic
946073217 2:217052136-217052158 TGGAAACCAGATCCCATGTTCGG - Intergenic
946540466 2:220678878-220678900 TGGAACACACTTCTAATCTTTGG + Intergenic
946600047 2:221349633-221349655 TTGCAGCCACTTCACATCTGAGG - Intergenic
946611177 2:221459475-221459497 TGGAAGCCACTGAACATCTGAGG + Intronic
947180991 2:227411300-227411322 TTCAAAACACTTCACATCTTTGG - Intergenic
948295150 2:236855202-236855224 TGGAGACCCCTAAACATCTTGGG - Intergenic
1170723142 20:18901789-18901811 TAGTAACCACTTCACATTGTGGG + Intergenic
1171164526 20:22958250-22958272 TGGAAACCAGTGCACAGCTTGGG + Intergenic
1174993590 20:55541126-55541148 TGGAAACCACATCGAATCTGCGG + Intergenic
1176970265 21:15256685-15256707 TGGAAATCATAACACATCTTCGG + Intergenic
1178361794 21:31954736-31954758 TGGATGCCACTGCACATCTCCGG - Intronic
1178810847 21:35879564-35879586 GGGAAATCTCTTCACATCCTGGG - Intronic
1178966858 21:37128289-37128311 AGGAAACCACTGCATATTTTTGG - Intronic
1178986376 21:37306778-37306800 TAGATACCACTTGACATCATTGG - Intergenic
1179401771 21:41090945-41090967 TGGAAACCACTTCCCCACCTTGG - Intergenic
950316961 3:12010582-12010604 GATAAACCACTTCGCATCTTTGG + Intronic
951199484 3:19861439-19861461 TGGAAACATCTTCAAATCCTGGG - Intergenic
952180551 3:30912232-30912254 TGGAAACCTCCTCAAACCTTTGG - Intergenic
953075560 3:39566980-39567002 TGCAAAACACTTTACATTTTGGG - Intergenic
953557295 3:43956599-43956621 TGGAAATCTCTACTCATCTTGGG + Intergenic
955057408 3:55468925-55468947 TGGAAAACAGTTCACTACTTAGG - Exonic
956952361 3:74297174-74297196 TGGGAACCACTATACAACTTAGG + Intronic
957715087 3:83917817-83917839 TGGAAGAAACTTCAGATCTTGGG - Intergenic
958702012 3:97603926-97603948 TGCAAACCACTTCTTAGCTTAGG + Intronic
963585003 3:147175892-147175914 TGGAAAACAGTTCACATCACAGG + Intergenic
965747888 3:171944595-171944617 AAGAAATCACTTCACCTCTTTGG - Intergenic
967721165 3:192817981-192818003 TGGAAAACACTGGACATATTTGG - Intronic
968283652 3:197495517-197495539 AGGAGACTACTTCACATCATGGG + Intergenic
971381976 4:26107426-26107448 AGGACACCACTTCAAATGTTTGG + Intergenic
972838739 4:42906524-42906546 TGGAACTCATTTCACATCTGAGG + Intronic
974597608 4:64035408-64035430 TGGTTATCACTTCAAATCTTAGG + Intergenic
975556940 4:75674185-75674207 AGGAAGCCACTTTGCATCTTAGG + Intronic
976783626 4:88790684-88790706 TGCGATCCACTTCACATGTTTGG - Intronic
979475173 4:121148476-121148498 TTCAAAACACTTGACATCTTCGG - Intronic
981263481 4:142751989-142752011 TTTAAACCACTTAACATCTGTGG + Intronic
981352415 4:143747677-143747699 TGGAAACTACTTCAGATTGTTGG + Intergenic
981354215 4:143768538-143768560 TGTAAATAACTTAACATCTTTGG + Intergenic
982250313 4:153399600-153399622 TGGCAAACACATCACCTCTTAGG + Intronic
982746543 4:159109367-159109389 TGGAAACCACTGAAAATCGTTGG + Intronic
983849152 4:172558836-172558858 TCAAAACTATTTCACATCTTTGG + Intronic
985843646 5:2328706-2328728 TGGAAACAACTACACATTTTAGG + Intergenic
986066914 5:4243345-4243367 TGGTAATCACTTCATATATTTGG + Intergenic
986742148 5:10713571-10713593 TGGAAAACACTTCAGCTCTCAGG - Intronic
987602391 5:20088432-20088454 TGGAAAATACTTCTCATTTTTGG + Intronic
991445798 5:66698773-66698795 TGAAGAACAATTCACATCTTGGG - Intronic
991594300 5:68287420-68287442 TGTAAACCACTTCACCTCCCTGG + Intronic
992212786 5:74496929-74496951 AGGAGACCCCTTCACATCTGTGG - Intergenic
993753102 5:91694300-91694322 TAGAAACCACATCACATTGTTGG - Intergenic
994745060 5:103667666-103667688 TGTAAACCAGTTCACATCCATGG - Intergenic
998188074 5:139998204-139998226 GGTAAACCACTTAACTTCTTTGG + Intronic
999070558 5:148739371-148739393 AGGAAACTATTTCACTTCTTTGG - Intergenic
1000510619 5:162177036-162177058 TGGAAACAACTTAACTTCTGAGG - Intergenic
1000838932 5:166191680-166191702 TGGAAACCAGGTGACAACTTGGG - Intergenic
1001196490 5:169677833-169677855 TGGAAACCACTTCAAAACTCTGG + Intronic
1002111265 5:176915073-176915095 TGGAAACCACTCCACAGATAGGG + Intronic
1002862415 6:1091831-1091853 TATAAACGACTTCACATATTAGG - Intergenic
1005661941 6:28007185-28007207 TTGAAACCACTTTACATTCTTGG - Intergenic
1006416713 6:33908654-33908676 TTGAATCCACTGCACATCTTTGG - Intergenic
1010203262 6:73300740-73300762 TGGAAAAAACTTCACCTCTTTGG + Intronic
1012082079 6:94772383-94772405 TGGAAACCATTACACATGTTTGG + Intergenic
1014061675 6:117079143-117079165 TGTAAACCAGTTCACAAATTAGG + Intergenic
1014471421 6:121819839-121819861 AGGAGACCACTTCCCATGTTAGG + Intergenic
1014491962 6:122073558-122073580 TGGAGACCACTTTTCCTCTTGGG + Intergenic
1014828911 6:126078488-126078510 TAGAAACCTCTTCACATCATGGG - Intergenic
1016097134 6:140052109-140052131 TGGAAACCACTGCACTTTTAGGG - Intergenic
1018034513 6:159870572-159870594 TGGAAAACACTTCAGAACATTGG - Intergenic
1020458978 7:8406483-8406505 TGGAGAGCACTTCACATCTGTGG - Intergenic
1020616927 7:10470498-10470520 TAAAATACACTTCACATCTTAGG + Intergenic
1023136966 7:37062433-37062455 TCTAAACCACTTCCCACCTTTGG - Intronic
1024977579 7:55127902-55127924 TGGAAACCACCTCACATGGTAGG + Intronic
1026527630 7:71169107-71169129 TGGGAACCACTACAGATCTCTGG + Intronic
1028467338 7:91167762-91167784 TGCAAATCACTTAACCTCTTAGG + Intronic
1030046211 7:105499078-105499100 TGGAAACCAGTTTACATAGTAGG - Intronic
1031692466 7:124806256-124806278 TGTAAATGACTTCACATCCTTGG - Intergenic
1031897372 7:127366666-127366688 TGGAAAGCTCATCACATTTTAGG + Intronic
1033383512 7:140847725-140847747 TGGAAATAATATCACATCTTGGG - Intronic
1038055707 8:23855796-23855818 TGGAAACCAGTTCATTTCTTGGG + Intergenic
1038445203 8:27598880-27598902 TGGAAACCACTTTTATTCTTTGG - Intronic
1038602846 8:28964827-28964849 GGGAAGGCACTTCACCTCTTTGG + Intronic
1042176585 8:66043267-66043289 AGGAACCCACTTCACATGTAAGG + Intronic
1042302599 8:67301527-67301549 GGCAAACCACTTCACTTCTCTGG - Intronic
1043361884 8:79482261-79482283 TGCTAACCACTTCACGTGTTTGG - Intergenic
1044031057 8:87238178-87238200 TGAAAACCATATCACATCTCAGG - Intronic
1044215424 8:89603890-89603912 TGGAAGCCACTGCAAATCTCAGG - Intergenic
1044276578 8:90307285-90307307 TGGAAACAACCTCAGATCTGAGG - Intergenic
1044805555 8:96005071-96005093 TGGAAACCAATACTCATCCTTGG - Intergenic
1044927487 8:97222032-97222054 GGGAATCCACGTCACATCTCTGG - Intergenic
1055673225 9:78628187-78628209 TGGAAACAACTTGTCATTTTGGG + Intergenic
1056046838 9:82727130-82727152 TGTAAACAACCTCACAGCTTTGG + Intergenic
1056738923 9:89236052-89236074 TGGCAACCACTTCCTACCTTTGG - Intergenic
1057417089 9:94873438-94873460 TGGGAAGCACCTGACATCTTTGG + Intronic
1057702185 9:97371410-97371432 TTTAAACCAGATCACATCTTGGG + Intronic
1058585100 9:106499518-106499540 TGGAAAGCTCTTCAGATGTTTGG - Intergenic
1058639831 9:107072612-107072634 AGCAAATCACTTTACATCTTTGG + Intergenic
1058783524 9:108363640-108363662 TGGTCACCACTTCATATCTGTGG + Intergenic
1059409585 9:114123724-114123746 TGGAACCAACTTCATATCCTGGG + Intergenic
1059898037 9:118890592-118890614 CAGAAACCACTTTACATATTAGG + Intergenic
1185886821 X:3790442-3790464 AGGAAACCACTGCCCATCCTGGG + Intergenic
1190622583 X:52302346-52302368 TGGCAAACACTGTACATCTTTGG - Intergenic
1192376062 X:70563507-70563529 AGTAACCCATTTCACATCTTAGG - Intronic
1193730338 X:85095419-85095441 TGGAAGCCACTTCAGCTCGTGGG - Intronic
1199388501 X:147251350-147251372 TGGTAGCAACTTCACATTTTAGG - Intergenic
1199562182 X:149174694-149174716 TGGCATCCACTTCAAAACTTTGG - Intergenic