ID: 1139681206

View in Genome Browser
Species Human (GRCh38)
Location 16:68565242-68565264
Sequence ACAGCCTATAAGGGTAAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139681202_1139681206 9 Left 1139681202 16:68565210-68565232 CCAAAGATGTGAAGTGGTTTCCA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139681206 Original CRISPR ACAGCCTATAAGGGTAAAGC TGG Exonic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905271393 1:36790018-36790040 ACAGGATATAAGGGAAAAGATGG - Intergenic
906176625 1:43779331-43779353 ACAGCCTATAAGGATAGGACTGG - Intronic
907643685 1:56219020-56219042 ACAGCCCAGAAGGGGAAAGAAGG + Intergenic
908315210 1:62925701-62925723 CCAGCCTATAGGGTTGAAGCAGG - Intergenic
909334455 1:74455413-74455435 ACAGACTATAAATGTAAAACTGG + Intronic
910035851 1:82787354-82787376 ACAGCACAAAAGGGGAAAGCTGG + Intergenic
1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG + Intronic
1065375352 10:25034817-25034839 ACAGCATTTAAGGGAAAAGGGGG - Intronic
1066637684 10:37522840-37522862 ACAGCCTAAAAGAGAACAGCTGG - Intergenic
1068315215 10:55332940-55332962 ACATCTTATAAAGGAAAAGCAGG - Intronic
1071669451 10:87594720-87594742 ACAGACTAGAAGGGGAAAGTTGG - Intergenic
1072606452 10:96987503-96987525 ACAGCCTAGAATGGGAAAGAAGG - Intergenic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1072894570 10:99355685-99355707 ACAGCCTGTAAGAGCAAAGCTGG - Intronic
1073080769 10:100859297-100859319 AGAGCCTAAAAGGGTGAAGAAGG - Intergenic
1079316847 11:19415372-19415394 ACACCCTTCCAGGGTAAAGCAGG + Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1082898037 11:58213888-58213910 ACAGCCTATCAGGGCAGAGGAGG - Intergenic
1084186002 11:67471801-67471823 ACAGTCCATAAGGGGACAGCAGG - Intergenic
1092284929 12:7123183-7123205 ACAGCCCAGAAGGGTGGAGCTGG - Intergenic
1093392550 12:18640230-18640252 ACAGTTTAAAAGAGTAAAGCTGG - Intronic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1100914013 12:99397616-99397638 ACAGCCCATAATGACAAAGCTGG - Intronic
1111118707 13:83816864-83816886 ACAGCCAAAAAGAGTAAAGAGGG + Intergenic
1114848893 14:26359057-26359079 AGAGCCTATCAAGGCAAAGCTGG - Intergenic
1120344792 14:83272499-83272521 ATAGACTATAAGGGTAAAACAGG + Intergenic
1120383402 14:83811935-83811957 AAAGCATATATGTGTAAAGCTGG + Intergenic
1121160315 14:91732783-91732805 TCAGGATATGAGGGTAAAGCAGG - Intronic
1124211081 15:27765604-27765626 ACAGCTTAGAAGGTTATAGCTGG + Intronic
1127550320 15:60031207-60031229 ATTGCCTATTAAGGTAAAGCAGG + Intronic
1130890765 15:88132051-88132073 ACAACCTTTAAGGTAAAAGCAGG + Intronic
1135686189 16:24500099-24500121 AGAGCTTGTAGGGGTAAAGCTGG + Intergenic
1135750125 16:25051513-25051535 CCAGCTTATAAGGATCAAGCTGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140610585 16:76593773-76593795 AGAGCTTCTCAGGGTAAAGCAGG - Intronic
1142844050 17:2658306-2658328 ACAGGTTAAAAGGGTAAAGAGGG + Intronic
1145930978 17:28685286-28685308 ACACCCTGAAAGGCTAAAGCAGG - Intronic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1150481870 17:65517046-65517068 TGAGGCTATAAGGGCAAAGCAGG - Intergenic
1151916463 17:77121759-77121781 ACAGCCTTTAACGGTGAATCAGG + Intronic
1153350943 18:4080741-4080763 ACAGCCTATAGTAGTAAATCGGG - Intronic
1158028957 18:52939161-52939183 AGTGCATATAAGGGGAAAGCAGG - Intronic
1159600944 18:70428141-70428163 ACAGCCTTTAAATGAAAAGCAGG - Intergenic
1168713824 19:58515994-58516016 CCAGCCTATAACGGGACAGCTGG + Intronic
926096781 2:10086428-10086450 ACATCCTACATGGCTAAAGCAGG - Intergenic
927700972 2:25268715-25268737 ACAGCCTCCATGGGTAAAGGGGG - Intronic
928218193 2:29380051-29380073 ACATCCTACACGGCTAAAGCAGG + Intronic
928694952 2:33840233-33840255 GCAGCCAATGTGGGTAAAGCTGG - Intergenic
938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG + Intergenic
944907406 2:204276287-204276309 TCAGCTTGGAAGGGTAAAGCAGG - Intergenic
946815614 2:223575575-223575597 AGAGTCTATTAAGGTAAAGCTGG + Intergenic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
1170118350 20:12885622-12885644 ACAACCCAGAAGGGTAAGGCAGG - Intergenic
1172071274 20:32259149-32259171 ATTGCCTTTATGGGTAAAGCAGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174532709 20:51226725-51226747 ACAGCCTATAAGGGATATGGTGG + Intergenic
1175909041 20:62395873-62395895 ACAGCCTCTCAGGGTGCAGCCGG + Intronic
1177922177 21:27165651-27165673 ACAACCCATAAGGGAAAAGATGG - Intergenic
950126465 3:10512864-10512886 ACAGCCCATCACGGTAAAGCAGG - Intronic
950399179 3:12757814-12757836 ACAGCCAAAAATGGAAAAGCTGG + Intronic
950748800 3:15112487-15112509 ACCGGCTTTAAGGGTAAACCAGG + Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
957547340 3:81656568-81656590 ACAGCCAATAAGGGAAAATTTGG + Intronic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
964919907 3:161884131-161884153 ACACCATATATGGCTAAAGCAGG - Intergenic
966242800 3:177773508-177773530 TCAGCCTATTAGGGTACAACAGG + Intergenic
967540433 3:190661004-190661026 AGAGCCTACAAGGGTAAAAGAGG - Intergenic
968964843 4:3764670-3764692 ACAGGCTCTGAGGCTAAAGCTGG + Intergenic
971921670 4:32948326-32948348 AAAGCCTACATAGGTAAAGCAGG + Intergenic
971960844 4:33485259-33485281 ACAGCCAGGAAGGGCAAAGCTGG + Intergenic
975438364 4:74380737-74380759 ACAACCTGTAAGGGTAGAGAAGG - Intronic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
979926510 4:126572662-126572684 AAAGCCTTTAAAGGTAAAGTGGG + Intergenic
980783027 4:137516445-137516467 ACAGCTTATAAATGTAAAGGTGG + Intergenic
980913865 4:139016406-139016428 ATGGCCTCTAAGGGTCAAGCGGG - Intronic
985937749 5:3109760-3109782 ACAGCCTGTCTGGGAAAAGCTGG + Intergenic
986802611 5:11277829-11277851 ACAGCATAAAAGCCTAAAGCAGG - Intronic
988691812 5:33580136-33580158 TCAACCTAAAAGGGTAAGGCAGG + Intronic
991429552 5:66530049-66530071 ACAGCCTATAAGAGAAGAGGTGG - Intergenic
993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
1000285312 5:159821407-159821429 AATGCTTATAAGGATAAAGCAGG - Intergenic
1009656616 6:66554752-66554774 ACACCCAATTATGGTAAAGCTGG - Intergenic
1012497494 6:99850130-99850152 ACTGCCTATAGGGGAAAAGGGGG - Intergenic
1014457589 6:121654203-121654225 GCAGCCGATGTGGGTAAAGCTGG + Intergenic
1016304582 6:142670573-142670595 ATGGCCTCTATGGGTAAAGCAGG + Intergenic
1020108318 7:5433192-5433214 AGAGCCTACAAGGGTCAAGTGGG + Intronic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1038352344 8:26788708-26788730 TCAGCCAATAAGAGTGAAGCTGG + Intronic
1044352823 8:91186505-91186527 AAAGCTTAAAAGGGTAAAGATGG + Intronic
1056699668 9:88891837-88891859 ACGGCCCATGAGGGGAAAGCAGG + Intergenic
1057588266 9:96348774-96348796 ACAATCTAAAAGGGTAAATCGGG - Intronic
1062043236 9:134413725-134413747 ACAGCCCCTCAGGGTCAAGCAGG - Intronic
1186565084 X:10653802-10653824 ACAGCCTTTAAAGGTATTGCTGG - Intronic
1190620119 X:52278882-52278904 ACAGGCTTTAAGGGTCAACCAGG - Intergenic
1190759487 X:53427777-53427799 ACAGCTCATAAGGGTAAGGTGGG + Intronic
1193777537 X:85662126-85662148 CCAGGTTATAAAGGTAAAGCAGG - Intergenic
1194938337 X:99978970-99978992 AGAGCCTAGAGGGGTAAAGAGGG - Intergenic
1195363618 X:104107328-104107350 ACTGGCTATGAGGGTAAAGGAGG - Intronic
1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG + Intronic
1199993621 X:153004765-153004787 ACAGAGTATAAGGGTGAAGAAGG - Intergenic
1200014631 X:153149033-153149055 ACAGCTTAAAAGGGTAAGGAAGG - Intergenic
1200024970 X:153250919-153250941 ACAGCTTAAAAGGGTAAGGAAGG + Intergenic
1201597621 Y:15689557-15689579 ACATTCTATAAGGGTAGAGCAGG + Intergenic
1201893518 Y:18969232-18969254 ACAGCCTAAAATTGTAAAGTTGG + Intergenic