ID: 1139682999

View in Genome Browser
Species Human (GRCh38)
Location 16:68580293-68580315
Sequence GCACCAGCGAGCACCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139682999_1139683009 10 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683009 16:68580326-68580348 ATTACTGTCCAGAGGTTGCCAGG No data
1139682999_1139683007 2 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682999_1139683010 17 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139682999_1139683012 27 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139682999 Original CRISPR GCACCAGCGAGCACCTTTGG GGG (reversed) Intergenic
No off target data available for this crispr