ID: 1139683007

View in Genome Browser
Species Human (GRCh38)
Location 16:68580318-68580340
Sequence CCTCCTTCATTACTGTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139683001_1139683007 0 Left 1139683001 16:68580295-68580317 CCCAAAGGTGCTCGCTGGTGCCC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682997_1139683007 7 Left 1139682997 16:68580288-68580310 CCTGGCCCCCAAAGGTGCTCGCT No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139683002_1139683007 -1 Left 1139683002 16:68580296-68580318 CCAAAGGTGCTCGCTGGTGCCCC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682993_1139683007 22 Left 1139682993 16:68580273-68580295 CCACTCCCGGGAGTGCCTGGCCC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682991_1139683007 29 Left 1139682991 16:68580266-68580288 CCATTTGCCACTCCCGGGAGTGC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682995_1139683007 16 Left 1139682995 16:68580279-68580301 CCGGGAGTGCCTGGCCCCCAAAG No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682994_1139683007 17 Left 1139682994 16:68580278-68580300 CCCGGGAGTGCCTGGCCCCCAAA No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682999_1139683007 2 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139682990_1139683007 30 Left 1139682990 16:68580265-68580287 CCCATTTGCCACTCCCGGGAGTG No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
1139683000_1139683007 1 Left 1139683000 16:68580294-68580316 CCCCAAAGGTGCTCGCTGGTGCC No data
Right 1139683007 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139683007 Original CRISPR CCTCCTTCATTACTGTCCAG AGG Intergenic
No off target data available for this crispr