ID: 1139683010

View in Genome Browser
Species Human (GRCh38)
Location 16:68580333-68580355
Sequence TCCAGAGGTTGCCAGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139683000_1139683010 16 Left 1139683000 16:68580294-68580316 CCCCAAAGGTGCTCGCTGGTGCC No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139683002_1139683010 14 Left 1139683002 16:68580296-68580318 CCAAAGGTGCTCGCTGGTGCCCC No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139683005_1139683010 -7 Left 1139683005 16:68580317-68580339 CCCTCCTTCATTACTGTCCAGAG No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139683001_1139683010 15 Left 1139683001 16:68580295-68580317 CCCAAAGGTGCTCGCTGGTGCCC No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139683004_1139683010 -6 Left 1139683004 16:68580316-68580338 CCCCTCCTTCATTACTGTCCAGA No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139683003_1139683010 -5 Left 1139683003 16:68580315-68580337 CCCCCTCCTTCATTACTGTCCAG No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139683006_1139683010 -8 Left 1139683006 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139682999_1139683010 17 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data
1139682997_1139683010 22 Left 1139682997 16:68580288-68580310 CCTGGCCCCCAAAGGTGCTCGCT No data
Right 1139683010 16:68580333-68580355 TCCAGAGGTTGCCAGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139683010 Original CRISPR TCCAGAGGTTGCCAGGTCAC AGG Intergenic
No off target data available for this crispr