ID: 1139683012

View in Genome Browser
Species Human (GRCh38)
Location 16:68580343-68580365
Sequence GCCAGGTCACAGGCATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139683005_1139683012 3 Left 1139683005 16:68580317-68580339 CCCTCCTTCATTACTGTCCAGAG No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683000_1139683012 26 Left 1139683000 16:68580294-68580316 CCCCAAAGGTGCTCGCTGGTGCC No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683004_1139683012 4 Left 1139683004 16:68580316-68580338 CCCCTCCTTCATTACTGTCCAGA No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683002_1139683012 24 Left 1139683002 16:68580296-68580318 CCAAAGGTGCTCGCTGGTGCCCC No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683006_1139683012 2 Left 1139683006 16:68580318-68580340 CCTCCTTCATTACTGTCCAGAGG No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683003_1139683012 5 Left 1139683003 16:68580315-68580337 CCCCCTCCTTCATTACTGTCCAG No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139682999_1139683012 27 Left 1139682999 16:68580293-68580315 CCCCCAAAGGTGCTCGCTGGTGC No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683001_1139683012 25 Left 1139683001 16:68580295-68580317 CCCAAAGGTGCTCGCTGGTGCCC No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data
1139683008_1139683012 -1 Left 1139683008 16:68580321-68580343 CCTTCATTACTGTCCAGAGGTTG No data
Right 1139683012 16:68580343-68580365 GCCAGGTCACAGGCATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139683012 Original CRISPR GCCAGGTCACAGGCATTTCC TGG Intergenic
No off target data available for this crispr