ID: 1139684295

View in Genome Browser
Species Human (GRCh38)
Location 16:68590717-68590739
Sequence GCAGGCTTCCTGCGGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139684295_1139684301 -4 Left 1139684295 16:68590717-68590739 CCGCCCGGCCGCAGGAAGCCTGC No data
Right 1139684301 16:68590736-68590758 CTGCAAGAGGCGAGCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139684295 Original CRISPR GCAGGCTTCCTGCGGCCGGG CGG (reversed) Intergenic
No off target data available for this crispr