ID: 1139691050

View in Genome Browser
Species Human (GRCh38)
Location 16:68642397-68642419
Sequence CTTGCCATCCAGAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139691050_1139691055 -8 Left 1139691050 16:68642397-68642419 CCCTCCACACTCTGGATGGCAAG 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1139691055 16:68642412-68642434 ATGGCAAGTCCGAAGGCGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1139691050_1139691057 21 Left 1139691050 16:68642397-68642419 CCCTCCACACTCTGGATGGCAAG 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1139691057 16:68642441-68642463 GTTCACTGTTGTATCTTAAGTGG 0: 1
1: 0
2: 2
3: 17
4: 166
1139691050_1139691058 25 Left 1139691050 16:68642397-68642419 CCCTCCACACTCTGGATGGCAAG 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1139691058 16:68642445-68642467 ACTGTTGTATCTTAAGTGGTTGG 0: 1
1: 0
2: 3
3: 13
4: 126
1139691050_1139691054 -9 Left 1139691050 16:68642397-68642419 CCCTCCACACTCTGGATGGCAAG 0: 1
1: 0
2: 1
3: 13
4: 208
Right 1139691054 16:68642411-68642433 GATGGCAAGTCCGAAGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139691050 Original CRISPR CTTGCCATCCAGAGTGTGGA GGG (reversed) Intronic
900103329 1:971979-972001 CTTGCCCTCCAGAGCTTGGCTGG - Intronic
900333582 1:2149526-2149548 CTGGCCATCCTGTGTCTGGAGGG + Intronic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
900626261 1:3610097-3610119 CTTGGCATCCGCAGTGTGAACGG - Intronic
901807635 1:11748337-11748359 CTTCCCATCCGGTGTGTGGCGGG + Intronic
902446638 1:16470171-16470193 ATTGCCCTCCCGAGTGTGGGTGG + Intergenic
903215590 1:21841854-21841876 CTTGCCATACAGAGACGGGAAGG + Intronic
904381459 1:30113968-30113990 CTTTTCATCCAGAGAGTAGAGGG + Intergenic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
912212142 1:107568130-107568152 CTTGCCCTACAAAGTGTGGCAGG + Intergenic
913056469 1:115166074-115166096 ATTTCCAGCCAGAGTGTTGAGGG - Intergenic
915559101 1:156676215-156676237 GGTGCCATCCAGAGAGTGGCGGG + Intronic
916196830 1:162232206-162232228 CTTGCCATTCTGAGTTTGAAAGG + Intronic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
923689270 1:236176786-236176808 CCTGCCACCTACAGTGTGGATGG + Intronic
924493070 1:244558917-244558939 CTGAGAATCCAGAGTGTGGATGG + Intronic
1067551436 10:47239150-47239172 CTTGCCAGGTAGAGTGTGGAAGG - Intergenic
1069632876 10:69908092-69908114 CTTCCCAGCCAGGGTCTGGAGGG - Intronic
1071347678 10:84707934-84707956 CTTGTCATAGAGACTGTGGAGGG - Intergenic
1071368727 10:84928345-84928367 CTGGCTGTCCAGAGTGTGGGAGG + Intergenic
1073125410 10:101146117-101146139 CTGGCCCTCTAGGGTGTGGAAGG + Intergenic
1073234043 10:101998092-101998114 CTTGCCATCCATAAAATGGAAGG - Intronic
1075276976 10:121103017-121103039 CTTGCAATTCAGTGTTTGGAAGG + Intergenic
1075710220 10:124526828-124526850 CTTCCCCTCCAGTGTGTGGTGGG + Intronic
1075814797 10:125256682-125256704 CTTTCCAGCCAGGGTGGGGATGG + Intergenic
1079312764 11:19380966-19380988 CTTACTATTCAGTGTGTGGAAGG - Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081542986 11:44049511-44049533 CTCTCCAGCCAGAGGGTGGAGGG + Intronic
1084282041 11:68103492-68103514 ATTGCCATCAACAGTGTGTAAGG - Intronic
1085662291 11:78379942-78379964 CATGCCATCAAGAGTATTGATGG - Intronic
1088027968 11:105209362-105209384 ATTGTCCTCCACAGTGTGGATGG + Intergenic
1089613982 11:119684959-119684981 CTCCCCATCCTGAGTGTAGAGGG - Intronic
1090420700 11:126573102-126573124 TTTTCCACCCAGAATGTGGAGGG - Intronic
1090622977 11:128577961-128577983 CTCGCCATCCAGGGTGATGAGGG - Intronic
1090774012 11:129947318-129947340 CCTTCCATCGAGAGTGTAGATGG - Exonic
1090937193 11:131353736-131353758 CTTGGTATCCAGAGTGTAAAAGG - Intergenic
1092095423 12:5838296-5838318 GCTGCCTTCAAGAGTGTGGAAGG + Intronic
1092814529 12:12301343-12301365 TTTGCCCTCCCCAGTGTGGATGG + Intergenic
1096309156 12:50505108-50505130 CTTGTCTTCCGGAGTGTGGCTGG + Exonic
1096534613 12:52263382-52263404 CTTACCACCCGGAGTGAGGATGG + Intronic
1099691071 12:85952458-85952480 CTTGCCCTCCAGCTTGTAGATGG - Intergenic
1100963656 12:99989882-99989904 CTGGCCATACAGACTGTGGGTGG + Intergenic
1101013746 12:100477788-100477810 GTTGCCATCCAGAATTTGCAGGG + Intronic
1103439074 12:120949826-120949848 CAAGCCTTCCACAGTGTGGAAGG + Intergenic
1104166882 12:126240158-126240180 TCTGCCAACCAGAGTGTGGCAGG + Intergenic
1106129623 13:26929573-26929595 ATTGCCCTCCTCAGTGTGGAGGG + Intergenic
1107127788 13:36863257-36863279 CTTGCCATAAAGCGTGTGGGTGG - Intronic
1109055466 13:57541940-57541962 ATTCCCATCCACAGTGTGCAAGG - Intergenic
1110837869 13:80105805-80105827 ATTGCCATCCACAGTTTGCAAGG + Intergenic
1111409341 13:87854035-87854057 GTTCCCATTCAGATTGTGGAAGG - Intergenic
1111595342 13:90403914-90403936 CTTGCCATCCATAGTGACCATGG - Intergenic
1113023488 13:105915255-105915277 CTTGCCTCCCGGGGTGTGGATGG + Intergenic
1114297322 14:21341609-21341631 CTTGCCTGCCACACTGTGGAAGG + Intronic
1114387202 14:22267622-22267644 CTTGCCAACTAGTGTGTGGCTGG - Intergenic
1114802196 14:25789663-25789685 CTTACCATCCACAGTTTGGGTGG + Intergenic
1118425042 14:65651140-65651162 CCTCCCAACTAGAGTGTGGAGGG + Intronic
1119941893 14:78649891-78649913 CATGCCATGCAGAGTTTGTATGG - Intronic
1120250111 14:82052809-82052831 CTTGCCATCCAGAGAATGGAGGG + Intergenic
1122951389 14:105047080-105047102 CATGCCAGGCAGAGTGGGGATGG + Intergenic
1123798839 15:23800457-23800479 ATTCCCATCAAGAGTGTGCAAGG - Intergenic
1125750087 15:42021959-42021981 CTGGCCTTCCAGAAAGTGGAGGG + Intronic
1126905076 15:53356269-53356291 CCTGACATCAAGTGTGTGGAAGG + Intergenic
1127934495 15:63623796-63623818 CCTGCCTTCCCGAGCGTGGAAGG - Exonic
1130724921 15:86429189-86429211 CTTGCCATCCGGAGTATGATAGG - Intronic
1131558004 15:93415833-93415855 CTTGGCATCCAGGCTGTGGAAGG + Intergenic
1132785695 16:1656099-1656121 CTGGGCATCCAGAGTGGGCAGGG + Exonic
1132832987 16:1938576-1938598 CAGGCCAGCCAGAGTGGGGATGG - Exonic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1136238248 16:28928048-28928070 CTTGACATGCGGAGTGTAGATGG + Intronic
1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG + Intergenic
1137931217 16:52589270-52589292 CCTGCCCTCCAGAGAGTGGCTGG - Intergenic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1140744055 16:77965512-77965534 TTTCCCATCCAGACAGTGGAGGG - Intronic
1141134983 16:81459243-81459265 CTTGGCATCCAGGCTGTGAAGGG + Intronic
1142345018 16:89548419-89548441 CTTGCCAGCCTGGGTGTGGTGGG + Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1147690156 17:42309902-42309924 CTGGCTATCCACAGTGAGGAAGG - Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149772050 17:59330457-59330479 CGTGCAAACCAGTGTGTGGAAGG + Intergenic
1150437730 17:65167134-65167156 TTTCCCATCCAGAGTGGGAAAGG + Intronic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1151329846 17:73400333-73400355 CTTGGATTCCAGCGTGTGGAAGG - Intronic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1151815723 17:76470504-76470526 CTGGCCATCCTCAGTGTGGTGGG + Intergenic
1156452378 18:37274189-37274211 CTCTCCCTCCAGAGTGAGGAGGG - Intronic
1157051937 18:44176365-44176387 CTGGGCACCCAGAGTGTGGGTGG - Intergenic
1158018588 18:52813710-52813732 ATTGCCATCCCTAGTGTGGGTGG + Intronic
1158906547 18:62018712-62018734 CTTGCCACCCACAGTCTGGGAGG - Intergenic
1159608164 18:70496496-70496518 GTTCCCATCCAGTGTGGGGAAGG + Intergenic
1163040741 19:14600252-14600274 CTTGCCATCCAGGGAAGGGAGGG - Intronic
1163321952 19:16579966-16579988 CATCCCTTCCAGAGTGGGGAAGG + Intronic
1165118367 19:33543282-33543304 CTTGCAAACCGGTGTGTGGAAGG - Intergenic
1166542915 19:43617410-43617432 CTTGACATCCAGACTTTGAAGGG - Intronic
1166935248 19:46328497-46328519 ATTCCCAGCCAGAGTGTTGAAGG - Intronic
1168137943 19:54364290-54364312 CTTACCCTCCTGCGTGTGGATGG + Exonic
1168159988 19:54503718-54503740 CTTACCCTCCTGCGTGTGGATGG - Exonic
1168228623 19:55014650-55014672 CATGTCATCCACAGTGTGCAGGG + Exonic
1168319170 19:55499057-55499079 CTTGGCATCCAGAGTGTTCGTGG + Intronic
1168644951 19:58053822-58053844 CTTGCCATGCTCAGTGAGGACGG - Exonic
925515250 2:4674534-4674556 CTTGGCACCCAAAGTCTGGAAGG - Intergenic
925856492 2:8134415-8134437 TGTGCCATCCTGAGAGTGGATGG + Intergenic
926270973 2:11365686-11365708 CTTGCCATCCACATTTTGGGAGG + Intergenic
926314931 2:11702482-11702504 TTTGCTATCCAGGGTGTGGCTGG - Intronic
928112068 2:28518740-28518762 CTTGCCTTCCTGTGGGTGGATGG + Intronic
929554126 2:42914208-42914230 GTGGGCATCCAGACTGTGGAGGG - Intergenic
929864911 2:45709570-45709592 CTTGGAATCCAGAATGGGGATGG - Intronic
934985329 2:98880996-98881018 ATAGCCATCCTGAGAGTGGAAGG - Intronic
939004286 2:136766949-136766971 CATGCCAACCAGACTGTGGTGGG + Intronic
942326245 2:174779211-174779233 CTTAACATCCTGAGTGTGGGTGG - Intergenic
943249560 2:185500216-185500238 CTTGCCATGCAAAGTGGGCATGG - Intergenic
944228749 2:197372691-197372713 CTTTTCATCCAGGGTGTGGAGGG + Intergenic
945062775 2:205923579-205923601 GATGCCTTCCAGAGTCTGGAAGG + Intergenic
946858296 2:223975391-223975413 CTTGCTATCAAGACTTTGGAGGG + Intronic
948103842 2:235396998-235397020 CTTTCCTTCCAGTGTGTGGGTGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948674772 2:239590429-239590451 TTTGCCCTCCAGAGTCTTGAAGG + Intergenic
1169408626 20:5348148-5348170 CTTGGCATCCACATTTTGGAAGG - Intergenic
1172239786 20:33405207-33405229 ATGTCCATCCAGATTGTGGAGGG - Intergenic
1174468400 20:50735495-50735517 CTAGCCATCCAGAATGTGTATGG - Intronic
1174679139 20:52387796-52387818 CTTGCCATCCCCAGTGTTGGAGG + Intergenic
1175632998 20:60557684-60557706 CTTGCCATCCTGTGTCGGGATGG - Intergenic
1176179888 20:63744840-63744862 CAGGACATCCTGAGTGTGGAGGG + Exonic
1177914748 21:27074952-27074974 ATTGCCCTCCACAGTGTGGATGG - Intergenic
1178884195 21:36472547-36472569 ATTGCCCTCCATAGTGTGGGTGG + Intronic
1179289435 21:40005910-40005932 GCTGGGATCCAGAGTGTGGATGG + Intergenic
1179893091 21:44347241-44347263 ATTGTAATCCACAGTGTGGAAGG - Intergenic
1180025846 21:45161615-45161637 CCTGCCATCCACAGTGTGCATGG - Intronic
1180032253 21:45220468-45220490 CTTGGCAGCCTGAGAGTGGATGG - Intronic
1181430324 22:22877583-22877605 CTTTCAACCCAGAGTGTGGCAGG + Intronic
1184227005 22:43134847-43134869 CTTGGGCTCCAGAGTCTGGAAGG - Intronic
950215869 3:11158512-11158534 ATTGCCTTCTAGAGAGTGGAAGG + Intronic
950988268 3:17400684-17400706 GTGCCCATCCAGAGTGAGGATGG - Intronic
953988115 3:47461143-47461165 TTTGCCTTGAAGAGTGTGGAGGG - Intronic
958161269 3:89818908-89818930 CTTGACACCCAAAGTCTGGAGGG + Intergenic
959320974 3:104875390-104875412 GTTTCCATCCAAAGTGTGAATGG - Intergenic
961627777 3:128275599-128275621 CATGGCTTCCAGAGTGTGGTGGG + Intronic
961634145 3:128322292-128322314 CTTGCCCTGCAGCTTGTGGAGGG + Intronic
961640895 3:128364290-128364312 CTTGCCATGCTGACTGTGAATGG - Intronic
962455152 3:135558252-135558274 ATTGCTATCCCCAGTGTGGATGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962935459 3:140076551-140076573 CCTGTCAGCCAGAGTGTGGGAGG - Intronic
963397372 3:144750814-144750836 GTTCCCTTCCACAGTGTGGAAGG + Intergenic
964510403 3:157444080-157444102 CTCCCCATCCACAGTGTGAAGGG - Intronic
964896988 3:161610265-161610287 CTTGCTTTCCATATTGTGGAAGG + Intergenic
967826632 3:193882430-193882452 CTCCCAATCCAGATTGTGGAGGG - Intergenic
968641771 4:1718414-1718436 CCTGCCAGCCAGACTGTGGGAGG + Exonic
969239581 4:5889711-5889733 GTTGCCATCCAGAGCGAGGGTGG + Intronic
969944202 4:10765999-10766021 ATGACCCTCCAGAGTGTGGATGG - Intergenic
974138693 4:57853210-57853232 CTTGCCATCTGGAGACTGGATGG - Intergenic
974833900 4:67223138-67223160 ATAGCCATCCATAATGTGGATGG - Intergenic
975720696 4:77245990-77246012 CTTCCCATCCAGAGGGTGGTGGG + Intronic
976073957 4:81275388-81275410 ATTGCCACCGACAGTGTGGAAGG - Intergenic
978914723 4:114109951-114109973 ATTGCAATCCAGTGTGTGGCTGG - Intergenic
979885336 4:126020650-126020672 CTTGCATTCCAGTGTGTGAAGGG - Intergenic
981564103 4:146080096-146080118 CTTACCCTCCACAATGTGGATGG - Intergenic
983998132 4:174210578-174210600 CTTGCCACCAAGAGAGTGGAGGG + Intergenic
988442560 5:31249508-31249530 GTGGCCATCCAGAATGAGGAAGG + Intronic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
990910692 5:60849391-60849413 ATTGCCATCCAAAGTATGGCTGG - Intergenic
992178609 5:74175014-74175036 CTTGCCATCCATTGTGTAAAAGG - Intergenic
992648735 5:78836558-78836580 CTTGCCATCCATAGACTGTAAGG - Intronic
994296692 5:98098126-98098148 ATTGCCCTCCATAGTGTGGGTGG - Intergenic
996362972 5:122670867-122670889 CTGGCCTTTCAGAGGGTGGAAGG - Intergenic
996933809 5:128924650-128924672 CATACCATCCAAAGTGTGGGAGG + Intronic
998367643 5:141641138-141641160 CCTGGCATCCAGAGTGGGGTGGG + Exonic
1000020281 5:157312135-157312157 CTTGCCATCCAGGTTGGAGATGG - Intronic
1000402584 5:160846824-160846846 CTTGCCAGCCACAATGTGGCAGG - Intronic
1001999564 5:176190073-176190095 CTGGCCATCCAGTGGGTGCACGG - Intergenic
1002166447 5:177350512-177350534 CTTGTCATCAGTAGTGTGGAGGG - Intronic
1007191436 6:40022269-40022291 CTTGCCATACAGAGCCTGAATGG - Intergenic
1011495533 6:87933597-87933619 CCTGGCATCCAGGATGTGGAGGG + Intergenic
1011964260 6:93134205-93134227 CTAACCATCCAGTGTGGGGAAGG - Intergenic
1014069648 6:117166765-117166787 ATTGCCCTCCAGAATGTGGGTGG + Intergenic
1017716660 6:157218021-157218043 ATTGCCAGCAAGAGCGTGGAAGG + Intergenic
1019019149 6:168902907-168902929 CCTGCCATCCACATTGTGGAAGG - Intergenic
1020967913 7:14895814-14895836 CTTGCCTTCCCTAGTGTGTATGG - Intronic
1022496437 7:30855842-30855864 GCTGCCTTCCAGAGTGAGGAGGG - Intronic
1023242039 7:38159252-38159274 CTTGGCAACCAGAGTGTTGCAGG - Intergenic
1024928356 7:54642127-54642149 CTTGCCCTCCCCAGTATGGATGG + Intergenic
1027442945 7:78239790-78239812 ATTGCCATCAACAGTGTGCAAGG - Intronic
1027443859 7:78249246-78249268 ATTGCCATCCACAGTGTGCAAGG - Intronic
1027730912 7:81871427-81871449 CTTACCATCCAGATGCTGGATGG - Intergenic
1029296325 7:99543317-99543339 CTTGCCACCCAGGGTGGGTATGG + Intergenic
1034269083 7:149794997-149795019 CTTGCCCTGCACACTGTGGATGG + Intergenic
1034633825 7:152551607-152551629 CATGCCGCCCAGAGTTTGGAAGG + Intergenic
1035552630 8:542016-542038 CATGCCCTCCAGAGGGTGAAGGG + Intronic
1035755691 8:2030102-2030124 ATTGCCCTCCACAGTGTGGATGG - Intergenic
1037414051 8:18629869-18629891 CTTACAATCCAGAATGTGCATGG - Intronic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1041020801 8:53636236-53636258 ATTACCCTCCATAGTGTGGATGG - Intergenic
1041140033 8:54807914-54807936 ATTGCCTTCCATAATGTGGACGG - Intergenic
1042204008 8:66310185-66310207 ATTGCCCTCCCCAGTGTGGATGG + Intergenic
1045361466 8:101437491-101437513 CTTACCATCCAGGGTGAGGGAGG - Intergenic
1045498874 8:102729977-102729999 CTTGCCTTCCCAAGTGAGGATGG - Intergenic
1046085302 8:109427037-109427059 TTTGCACTCCAGAGTCTGGAGGG + Exonic
1046130823 8:109966278-109966300 CTTTCCCTTCAGATTGTGGAAGG + Exonic
1046195668 8:110860309-110860331 ATTGGCATCCAAAGTTTGGAGGG - Intergenic
1047024909 8:120813725-120813747 TTTTCCATCCTGAGAGTGGATGG - Intergenic
1047252910 8:123194027-123194049 ATTTCCATCCGGAGTGTGGAAGG + Exonic
1049020839 8:139956803-139956825 CTTGTCCTCCAGGGTGTGGGAGG - Intronic
1049218882 8:141419962-141419984 GCTGCCACCCAGGGTGTGGAGGG + Intronic
1049365270 8:142234001-142234023 CTAGCCATCCTGAATGTGGCAGG + Intronic
1049871323 8:144979936-144979958 TTTGCCATTCAGAGTATGAAAGG + Intergenic
1052029353 9:23610778-23610800 CTTGCACTCCAGGGTTTGGATGG + Intergenic
1053025600 9:34725988-34726010 CTTGTCCCCCAGACTGTGGATGG + Exonic
1053037128 9:34835050-34835072 CTTGTCCCCCAGACTGTGGATGG + Intergenic
1053603646 9:39634647-39634669 ATTACCCTCCATAGTGTGGAAGG - Intergenic
1053861529 9:42391007-42391029 ATTACCCTCCATAGTGTGGATGG - Intergenic
1054249894 9:62707772-62707794 ATTACCCTCCATAGTGTGGAAGG + Intergenic
1054564004 9:66742294-66742316 ATTACCCTCCATAGTGTGGAAGG + Intergenic
1056982113 9:91323827-91323849 CTTTCTATCCATAGTGTGCATGG - Intronic
1057312556 9:93951357-93951379 CTTGCCAGCCAGAGAGTCGCTGG - Intergenic
1058327041 9:103711316-103711338 ATTCCCATCAAGAGTGTGTAAGG + Intergenic
1060365660 9:123010464-123010486 TTTGCGATCCAGACTGTGGCAGG - Exonic
1061432789 9:130541968-130541990 CTTGCCTTCCAGAGTCAAGAGGG - Intergenic
1062414540 9:136441545-136441567 CTTTCCATCCAGAATCTGAAAGG + Exonic
1193271209 X:79531532-79531554 CTTCCCTTCCACATTGTGGAGGG + Intergenic
1193416787 X:81235335-81235357 CTTACAACCCAGAGTTTGGAAGG + Intronic
1194908354 X:99607734-99607756 ATTGCCCTCCATAATGTGGATGG + Intergenic
1198658118 X:138936819-138936841 CTTGCGGTCCCCAGTGTGGAGGG - Intronic
1200706768 Y:6449744-6449766 CCTGCCATCCAGGTTGTGGGTGG - Intergenic
1201027344 Y:9714964-9714986 CCTGCCATCCAGGTTGTGGGTGG + Intergenic