ID: 1139698404

View in Genome Browser
Species Human (GRCh38)
Location 16:68691940-68691962
Sequence CCATCCTCAGGGAGGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139698404_1139698417 -6 Left 1139698404 16:68691940-68691962 CCCCACCCCCTCCCTGAGGATGG 0: 1
1: 1
2: 5
3: 39
4: 489
Right 1139698417 16:68691957-68691979 GGATGGGGGAGTTGAAAGACTGG 0: 1
1: 0
2: 1
3: 32
4: 321
1139698404_1139698420 30 Left 1139698404 16:68691940-68691962 CCCCACCCCCTCCCTGAGGATGG 0: 1
1: 1
2: 5
3: 39
4: 489
Right 1139698420 16:68691993-68692015 CTTTAACTCCTGGAACTAAGAGG 0: 1
1: 0
2: 0
3: 18
4: 254
1139698404_1139698418 20 Left 1139698404 16:68691940-68691962 CCCCACCCCCTCCCTGAGGATGG 0: 1
1: 1
2: 5
3: 39
4: 489
Right 1139698418 16:68691983-68692005 CTACCTTGAGCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139698404 Original CRISPR CCATCCTCAGGGAGGGGGTG GGG (reversed) Intronic
900206667 1:1434634-1434656 GCATCCTCCAGGAGAGGGTGGGG + Intergenic
900227031 1:1537769-1537791 CCGTGCACAGGGCGGGGGTGTGG - Intronic
900265022 1:1753128-1753150 CCATTCCCAGGGAGGGAGGGAGG - Intronic
900342499 1:2195468-2195490 CCACCCTCACGGAAGGAGTGGGG + Intronic
900390803 1:2433017-2433039 CCAACCTCAGGGATGGGAGGGGG - Intronic
900589480 1:3453414-3453436 CCATCCCCTGGGAGGGAGGGTGG - Intergenic
900673638 1:3870728-3870750 GCGGCCCCAGGGAGGGGGTGGGG + Intronic
900803997 1:4755540-4755562 CCATGGGCAGGCAGGGGGTGGGG - Intronic
900850314 1:5137179-5137201 GCAACCTCAGTGAGGGAGTGAGG - Intergenic
900991619 1:6100753-6100775 CCATCTACAGGGAGGATGTGAGG + Exonic
901491510 1:9598636-9598658 GCATCCACAGGGCGGGGGTGGGG + Intronic
901829062 1:11881135-11881157 CCACCCACAGGGAGGGGCTTTGG - Intergenic
902039277 1:13481126-13481148 CCATCTTGTTGGAGGGGGTGGGG - Intronic
902205862 1:14867726-14867748 CCATGCCCAGGGTGGGGGGGGGG - Intronic
902741191 1:18439500-18439522 CCCTCCTCAGGGTGGGGTGGGGG + Intergenic
903279876 1:22244347-22244369 ACATCCTCTTGCAGGGGGTGGGG + Intergenic
903342345 1:22662295-22662317 CCTGCTTCAGGGAGGAGGTGTGG - Intergenic
903356559 1:22751698-22751720 CCATCCTCAGGTAGGAAATGGGG + Intronic
903572864 1:24319243-24319265 CCTTCCTTGGTGAGGGGGTGGGG - Intergenic
903810126 1:26030689-26030711 CCATCTTCAAGGAAGGGGGGGGG - Intronic
904082359 1:27880137-27880159 TGATCCTCAGGGATGGGGTGGGG - Intronic
904277620 1:29394730-29394752 CCATGCTCAGGGATGGGGGGTGG - Intergenic
905107324 1:35572151-35572173 CCATTTTCAGGGGAGGGGTGAGG - Intergenic
905138976 1:35825727-35825749 CCACCCTCTGGGAGGGGGCAGGG + Exonic
905155309 1:35973423-35973445 CCACCCTCTGGGAGGGGGCAGGG + Exonic
905442765 1:38005525-38005547 ACTTCCTCGGGGAGGGGTTGGGG - Intronic
905455250 1:38084043-38084065 CCTTCCACAGTGGGGGGGTGGGG - Intergenic
906125610 1:43425306-43425328 CCAAAGTCAGGGAGGGGGTGCGG + Intronic
906519552 1:46459006-46459028 CCATCTTCAGGGTGGGGCTTAGG + Intergenic
906615204 1:47229079-47229101 CCATTCTCAGATTGGGGGTGGGG - Intronic
906826566 1:48987864-48987886 CCATCCTCAGGGATCCAGTGTGG + Intronic
907239601 1:53074237-53074259 CCATCCACAGGCAGGGGGGCCGG - Intronic
907670703 1:56472711-56472733 CCAGGCTCAGGGTAGGGGTGAGG - Intergenic
910729527 1:90377970-90377992 TCATTCTCAGGGAGGGGGCTGGG + Intergenic
911359808 1:96862636-96862658 CCATGCTCCTGGAGTGGGTGAGG + Intergenic
913098947 1:115545565-115545587 CCAGGCTCACGGAGGGAGTGAGG - Intergenic
913679007 1:121170923-121170945 TCATTCTTAGGGTGGGGGTGGGG - Intronic
914030839 1:143958569-143958591 TCATTCTTAGGGTGGGGGTGGGG - Intronic
914158610 1:145109393-145109415 TCATTCTTAGGGTGGGGGTGGGG + Intronic
914705105 1:150163741-150163763 CCAACCCCAGGGTTGGGGTGAGG - Intronic
915282137 1:154829831-154829853 CCAGCCTCGGGAAGGGTGTGGGG - Intronic
915467159 1:156104487-156104509 CAACCATGAGGGAGGGGGTGAGG - Intronic
915513615 1:156400564-156400586 CCAACCTCAGAGAGGGGGAGAGG - Intergenic
915515438 1:156409824-156409846 CCCTCCTGAGGGAGGGAGTTGGG - Intronic
915565455 1:156710418-156710440 CCATCCTCAGAGGGTGGGAGAGG - Intergenic
917442135 1:175077602-175077624 CCATCGTCACTGAGGGGCTGAGG - Exonic
920062368 1:203236270-203236292 CCATCCTCTGGGAAGGGGAGTGG + Intronic
920195518 1:204223660-204223682 CCCTCCCCAGGCAGGGAGTGAGG + Intronic
920281110 1:204844350-204844372 CTACCCTCAGGAAGGGAGTGGGG - Intronic
920373403 1:205493471-205493493 CCATCCTAGGGGCAGGGGTGAGG - Intergenic
920466307 1:206189461-206189483 TCATTCTTAGGGTGGGGGTGGGG - Intronic
922460866 1:225813462-225813484 CCCTCCTCAGGAGAGGGGTGTGG - Intronic
922567089 1:226607954-226607976 CCATCCTGGAAGAGGGGGTGTGG - Exonic
923034051 1:230271869-230271891 CCATCCTCTGGGAAGGGAAGAGG - Intronic
923229042 1:231966566-231966588 CCATCCTCAGGGGGAGGGCTTGG - Intronic
923283480 1:232467419-232467441 CCATCCTGAGGATGGTGGTGAGG - Intronic
923749825 1:236737245-236737267 CCATCCTCACGCAGGGGCTGAGG + Intronic
923755961 1:236791441-236791463 CCAGGCACAGGGTGGGGGTGGGG - Intergenic
1063862678 10:10328619-10328641 GCTTCCTCAGAGAGGGGTTGAGG + Intergenic
1063970886 10:11380544-11380566 CCATCCTCGGGGAGGGGAGAAGG + Intergenic
1064182224 10:13127887-13127909 CCATCCTCAGGGCTCAGGTGAGG + Exonic
1064442846 10:15370057-15370079 CAAGCCTCAGGGTGGGTGTGGGG + Intronic
1067039529 10:42941671-42941693 GCACCCTCAAGGAGCGGGTGCGG - Intergenic
1069837697 10:71319532-71319554 CCAGTCTCAGGGAGGAGGAGGGG - Intronic
1069957403 10:72060493-72060515 TCCTCCTCGGGGTGGGGGTGGGG - Exonic
1070674876 10:78405697-78405719 CCAGTCTCAGGCAGGGGTTGGGG - Intergenic
1070954522 10:80455116-80455138 CCACCCCCAGGGGTGGGGTGCGG + Intronic
1071482001 10:86071690-86071712 GCATGCTGAGGGAGGTGGTGGGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1074875429 10:117609816-117609838 TCACCCTCAGGGAGTGGCTGTGG - Intergenic
1075266075 10:121000434-121000456 CCATCATCCAGGAGGGAGTGGGG + Intergenic
1075648196 10:124110132-124110154 GCATCTTCAGGGTGGAGGTGAGG - Intergenic
1075679452 10:124322018-124322040 CCATCTGCAGGGACAGGGTGTGG - Intergenic
1075932535 10:126311599-126311621 CCATCCTCTGGGGAGGGGAGAGG + Intronic
1076284475 10:129279597-129279619 TCATCCCCGGGGATGGGGTGGGG - Intergenic
1076691426 10:132225561-132225583 CCATCATCAAGGACGGGGAGCGG - Exonic
1076922657 10:133462871-133462893 CCAGACTCAGTGAGAGGGTGTGG + Intergenic
1077439188 11:2560252-2560274 CCATCCTGGGGGAGTGGGGGCGG + Intronic
1077439199 11:2560281-2560303 CCATCCTGGGGGAGTGGGGGCGG + Intronic
1077460913 11:2709062-2709084 GCAGCCTCAGGGAGGGGCGGTGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1077896307 11:6456243-6456265 CCAGGCTCAGGTAGTGGGTGGGG - Intronic
1078891240 11:15560692-15560714 GCATCCTCAGGCAGAGGCTGTGG - Intergenic
1079364377 11:19796642-19796664 CCCTCCACAGAGAGGTGGTGTGG - Intronic
1079668930 11:23141891-23141913 CCAGGCTCAGGGTGGTGGTGGGG - Intergenic
1081993050 11:47347826-47347848 CCATCCTCAGGGCCTGGGGGAGG - Intronic
1082309842 11:50633045-50633067 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1082824780 11:57569440-57569462 CCCTCTTCAGGGAGGGGCAGAGG + Intergenic
1083263881 11:61537335-61537357 TCCGTCTCAGGGAGGGGGTGGGG - Intronic
1083287524 11:61669948-61669970 CCCCGCTCAGGGATGGGGTGAGG - Intergenic
1083340322 11:61955089-61955111 CCAGCCTGGGGGTGGGGGTGGGG - Exonic
1083428027 11:62599288-62599310 CCAACCTCAGGGAGAAGGGGGGG + Intronic
1083655015 11:64225398-64225420 CCTTCCTCAGGGAGCGGTGGAGG + Intronic
1083994891 11:66267003-66267025 CCATGCGCAGGGCTGGGGTGAGG - Exonic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1084174513 11:67416338-67416360 GCAGCCGCAGGGTGGGGGTGGGG - Intronic
1084697354 11:70763567-70763589 CCAGCCTCATGAAGGGGCTGAGG + Intronic
1085323782 11:75591478-75591500 CCAGCCTCACGGAGGAGGTGGGG - Intronic
1085354438 11:75822898-75822920 CCATCCTCCAGGAAGGGGAGAGG - Intronic
1086158082 11:83690669-83690691 CCATGCTGTGGGTGGGGGTGGGG + Intronic
1086699038 11:89878537-89878559 TCAACCTCAGGAAGTGGGTGTGG - Intergenic
1086707133 11:89965965-89965987 TCAACCTCAGGAAGTGGGTGTGG + Intergenic
1087165525 11:94998834-94998856 CCATCCTCAGGTAGGGGCTCAGG - Exonic
1087638251 11:100727530-100727552 CCACCCTCTGGGAAGGGGAGAGG + Intronic
1087680614 11:101215010-101215032 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1087812227 11:102620885-102620907 GAATCCTCAGGGAGGGGGTGAGG + Intronic
1087965835 11:104413974-104413996 CCATCCTCTGAGAAGGGGAGAGG + Intergenic
1089535458 11:119158316-119158338 CCATCCTCAGGGACACGGTGAGG + Exonic
1089620017 11:119716764-119716786 CCAACCCCAGGAGGGGGGTGAGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1090289392 11:125528610-125528632 CAAACCTCTGGGAAGGGGTGGGG + Intergenic
1091403232 12:193470-193492 CCCTGCACAGGGCGGGGGTGAGG - Intronic
1092782090 12:11996648-11996670 CCAACCTCAGGGAGGGGGAGTGG - Intergenic
1094865633 12:34527394-34527416 CAATCCTCAGGGACAGGCTGTGG + Intergenic
1095794184 12:46199112-46199134 GCTTGCTCAGGGAGGGGGTGGGG + Intronic
1096628580 12:52910760-52910782 GAATCCTCAGGGCTGGGGTGGGG - Intronic
1096749397 12:53749063-53749085 CCATGCAGAGGGAGGGTGTGTGG - Intergenic
1098022365 12:66169670-66169692 CCCTCCTCAGGGAGTCGGGGAGG - Intronic
1098275487 12:68808052-68808074 CCATCATCCCGGAGGTGGTGCGG + Intergenic
1099555447 12:84103809-84103831 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1101501772 12:105310877-105310899 CAATCCTCAGGGACAGGCTGTGG + Intronic
1101875971 12:108597258-108597280 CCAGTCTCTGGGTGGGGGTGGGG - Intronic
1102712914 12:114943924-114943946 CCACCATCAAGGTGGGGGTGAGG + Intergenic
1103341842 12:120224984-120225006 CCCTGCTCACTGAGGGGGTGGGG - Intronic
1103343769 12:120235679-120235701 CCCTCCTGAGGCAGAGGGTGAGG - Intronic
1104320636 12:127747643-127747665 CTATCCTCAGGGAGGGAGGGAGG - Intergenic
1104548383 12:129732821-129732843 CCACACCCAGGGAGGGGATGGGG + Intronic
1104771200 12:131366018-131366040 CCATCCAGAAGGAGGCGGTGGGG - Intergenic
1104792462 12:131492683-131492705 CCACCCTCAGTGCGGGGGAGAGG - Intergenic
1104815595 12:131643824-131643846 CCATCCCCAGGTGGTGGGTGGGG + Intergenic
1105513093 13:21067406-21067428 CCATCCTCCAGGAAGGGGAGAGG + Intergenic
1105541715 13:21321600-21321622 CCAGCCCCTAGGAGGGGGTGGGG + Intergenic
1105881757 13:24612171-24612193 CCTTCCACAGCGAGGGGGTTGGG + Intergenic
1105946990 13:25198525-25198547 ACATCCTGAGTGAGGGGCTGAGG + Intergenic
1105993798 13:25650126-25650148 CCAACTTGAGGGATGGGGTGGGG + Intronic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1107031028 13:35853909-35853931 CCACCCTAAGGAAGAGGGTGAGG - Intronic
1107520124 13:41171970-41171992 CCCGTCTCAGGGAGGGGGAGAGG + Intergenic
1107666970 13:42700415-42700437 CCTTCCTCATGCTGGGGGTGGGG - Intergenic
1109322102 13:60823528-60823550 CCATTGTGATGGAGGGGGTGGGG + Intergenic
1110392215 13:74986963-74986985 CATTCCTCAGGGAGGGAGGGGGG + Intergenic
1111510154 13:89250612-89250634 CCATCCTCAGGGGCGTGTTGGGG - Intergenic
1113473221 13:110561545-110561567 CCAGCCTCGGGGAGAGGGCGCGG - Exonic
1113483946 13:110641171-110641193 TCCTCCTGAGGGAGGGGCTGGGG - Intergenic
1113709342 13:112453527-112453549 GAATCCTCAGTGAGAGGGTGAGG + Intergenic
1114522261 14:23347025-23347047 CTGTCCTCAGGGGTGGGGTGGGG + Intronic
1115468146 14:33738616-33738638 CTTTCCTGAGGAAGGGGGTGTGG - Intronic
1115568633 14:34646950-34646972 CCATCCTGAGGCAGTGGGTGTGG + Intergenic
1115781967 14:36778554-36778576 CAAGCCACAGGGTGGGGGTGAGG + Intronic
1116560178 14:46368575-46368597 CCTTCCCCAAGGAAGGGGTGAGG - Intergenic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1117745533 14:58865653-58865675 GAATCCTCAGGGCTGGGGTGTGG + Intergenic
1118494328 14:66293399-66293421 GCATCTTCAGGGAGGAGGAGTGG - Intergenic
1119161682 14:72458125-72458147 CCTTGCTCAGTGTGGGGGTGAGG - Intronic
1119194133 14:72704520-72704542 CCTACCTCAGGCAGGGGGTGGGG - Intronic
1119199995 14:72745078-72745100 GCATCCTCAGGGGGTGGGTGTGG + Intronic
1120168139 14:81221507-81221529 CCACCCTCGGTGAGGCGGTGAGG - Intergenic
1120961464 14:90128895-90128917 CCGTCCTCAGGTTGGCGGTGGGG - Intronic
1121365324 14:93303833-93303855 CCTTCCTCTGGTGGGGGGTGGGG - Intronic
1122321710 14:100859497-100859519 CCAGCCTCAGGGAGGGCATGGGG - Intergenic
1122346100 14:101061555-101061577 GCATCCTCAGAGGGTGGGTGGGG - Intergenic
1122632061 14:103111661-103111683 CCATCTCCAGGGCTGGGGTGGGG + Intergenic
1122738179 14:103855632-103855654 CCCTCCCCAGTGTGGGGGTGGGG + Intergenic
1122862365 14:104588366-104588388 CCTCCCTCGGGGAGGGAGTGAGG - Intronic
1122918155 14:104868261-104868283 CCATACCCAGGGAGGGCGGGTGG + Intronic
1123124561 14:105937297-105937319 CCTTCCTCATGGGGAGGGTGTGG - Intergenic
1124413504 15:29456096-29456118 CCATGGACAGGGAGGGGGTGGGG - Intronic
1125473774 15:40030128-40030150 CTCTCCTCAGGCAGGGGTTGGGG - Intronic
1126185779 15:45829520-45829542 CCATTCTCAGAGCGGGGTTGGGG - Intergenic
1127281950 15:57500321-57500343 CCATTGTCAGGGAGTGGGAGAGG + Intronic
1128109365 15:65067180-65067202 CCTTCTACGGGGAGGGGGTGTGG + Intronic
1129412087 15:75355744-75355766 CCATCCTCACGCTTGGGGTGGGG - Exonic
1129674856 15:77627018-77627040 CTCGCCTCTGGGAGGGGGTGGGG - Intronic
1129829791 15:78661256-78661278 GCATCCTCAGGGCGGGGCAGGGG - Intronic
1132247564 15:100309454-100309476 CCATCCTCACTGAGGGGGCTTGG - Intronic
1132366594 15:101262231-101262253 CCAACCTCAGGGAGGGGAGAGGG - Intergenic
1132557206 16:577936-577958 CCAGCCTCTGCGATGGGGTGGGG + Intronic
1132610001 16:810871-810893 CCCTCAGCAGGGAGGAGGTGTGG + Intronic
1132640280 16:975020-975042 CCAGCCTCACGTGGGGGGTGGGG - Intronic
1132640614 16:976644-976666 CCACTCTCAGTGTGGGGGTGGGG - Intronic
1132810454 16:1794370-1794392 CCATCCTCGGGGAGTGTGTGGGG + Intronic
1133385311 16:5365047-5365069 GATTCCTCAGGGAGGGAGTGGGG + Intergenic
1134098216 16:11433678-11433700 CCATCCTCTGAGAAGGGGAGAGG + Intronic
1134452512 16:14372208-14372230 TAATCCTGAGGGAGGGGGTGGGG - Intergenic
1134518343 16:14905027-14905049 CCATCGTCAAGGAGGTGGAGCGG + Intronic
1134555586 16:15161196-15161218 CCATCGTCAAGGAGGTGGAGCGG - Intergenic
1134667957 16:16033187-16033209 CAGACCTCAGGGAGGTGGTGGGG + Intronic
1134706014 16:16303682-16303704 CCATCGTCAAGGAGGTGGAGCGG + Intergenic
1134961526 16:18408428-18408450 CCATCGTCAAGGAGGTGGAGCGG - Intergenic
1134965826 16:18491031-18491053 CCATCGTCAAGGAGGTGGAGCGG - Intronic
1136116065 16:28095567-28095589 CCATTCTGAGGAAGGGGATGGGG - Intergenic
1136147612 16:28324609-28324631 CCATCGTCAGGGAGCGTCTGTGG - Intergenic
1136174555 16:28507925-28507947 CCATCTTCAGGGAGAGGATGGGG + Intronic
1136272456 16:29156553-29156575 CCGTCCTCAGGGTGGGGCTGTGG - Intergenic
1136295125 16:29297302-29297324 TCTTCCCCAGGGAGGGGGTTAGG + Intergenic
1137529648 16:49270390-49270412 CTATCCCCAGGGAGGGAGAGAGG + Intergenic
1137709427 16:50555957-50555979 CCTTCCTCAGGGAGAGGGTGGGG - Intronic
1138530088 16:57630172-57630194 CTATCCTCTGGGAGGGGCAGGGG - Intronic
1138630904 16:58293500-58293522 CAATCCTTAGGGTGGGAGTGTGG - Intronic
1138884716 16:61062552-61062574 CCAGTATCAGGGTGGGGGTGGGG + Intergenic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1140035777 16:71370266-71370288 CCAGCCTCTGTGAGGGGTTGTGG - Intronic
1141055787 16:80812482-80812504 CCATCCTAGGGATGGGGGTGGGG - Intergenic
1141159892 16:81622192-81622214 CCATCGTTAGGAAGGGGCTGAGG + Intronic
1141179645 16:81743728-81743750 CCATCCCAAGGGAGGGAGAGTGG + Intronic
1142076015 16:88118362-88118384 CCGTCCTCAGGGTGGGGCTATGG - Intronic
1142123968 16:88401045-88401067 CCAGGGTCAGGGAGGGGCTGGGG - Intergenic
1142151984 16:88516721-88516743 TCCTCCTCAGGGAGGGGTCGGGG - Intronic
1142349634 16:89574298-89574320 CAAACCTCAGGGCGGTGGTGAGG + Intergenic
1142682517 17:1558778-1558800 CCATTCTCTGGGGGGGGGGGCGG - Intronic
1142750189 17:1982848-1982870 CGAACCTCAGGGAGGGGCAGCGG + Intronic
1144580588 17:16456882-16456904 CCATCTTCAGGGATCGGGGGAGG - Intronic
1144795961 17:17891450-17891472 GCATCCTCAGGGTAGAGGTGTGG + Intronic
1144851464 17:18246150-18246172 TCATCCTCAAGGTGGGGTTGTGG - Exonic
1145801608 17:27689781-27689803 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1145974429 17:28976122-28976144 CCATCCACAGGGAGGAGGCCAGG - Intronic
1146182642 17:30707837-30707859 CCCACCCCAGAGAGGGGGTGCGG + Intergenic
1146454389 17:32997702-32997724 CCATCCTCAGGGAGGCCTGGAGG + Exonic
1146804556 17:35855019-35855041 GCATCTTCAGGGAGGGAGTCGGG + Exonic
1147164724 17:38587110-38587132 CCAGTCTGAGGGAGGAGGTGAGG - Intronic
1147325206 17:39666670-39666692 CCATACTTGGGGTGGGGGTGGGG + Intergenic
1147464779 17:40602718-40602740 CCATGCTCAGGGAGGAGGATGGG - Intergenic
1148051653 17:44772625-44772647 CCAGCATTAGGGAAGGGGTGGGG - Intronic
1148207328 17:45787273-45787295 CTATCCCCAGGGAGGGGCAGGGG + Intronic
1148322757 17:46767391-46767413 CCAACCTCAGGGAGGTGGGTGGG - Intronic
1148329109 17:46802606-46802628 CCATCCTTTGGGAAGGGGAGAGG + Intronic
1148469628 17:47885070-47885092 CCCTCAGCAGGGTGGGGGTGGGG + Intergenic
1148782464 17:50129656-50129678 CCATCCCGGGGGTGGGGGTGAGG + Exonic
1148814700 17:50319187-50319209 CCATTCTCGGGGAGGCCGTGAGG + Intergenic
1150400271 17:64850807-64850829 CCATCCTCTGGGGTGGGGAGTGG + Intergenic
1151104886 17:71601631-71601653 AGATCCTCAGGCAGGGGGTCTGG + Intergenic
1151528697 17:74689979-74690001 CCAGCCTCAGGGACAGAGTGAGG - Intronic
1151635599 17:75345703-75345725 CCACCCTGGGGGTGGGGGTGGGG - Intronic
1152032814 17:77854449-77854471 CCAGCTTCAGCCAGGGGGTGGGG + Intergenic
1152235727 17:79137396-79137418 ATATCCTCAGGCAGGGGGCGGGG + Intronic
1152360092 17:79828837-79828859 ACAACCTCAGGGAGGGGATGGGG + Intergenic
1152409804 17:80117658-80117680 CCATCCACAGCGAGGGGCAGTGG + Intergenic
1152579531 17:81159952-81159974 TCACCCTCGGGGAGGGTGTGGGG - Intronic
1152615052 17:81334100-81334122 ACCTCCTCAGGCAGGGGGTGAGG + Intergenic
1152631050 17:81410824-81410846 CCAGTCTCGGGGCGGGGGTGGGG + Intronic
1152639731 17:81444531-81444553 CCATCCACAGGGAGGGGCTGCGG - Exonic
1152678509 17:81653696-81653718 TCACCCACAGGGAGGTGGTGAGG - Intronic
1152736071 17:81997414-81997436 CCCTGCTCAGGTAGGAGGTGGGG - Intronic
1153238726 18:3012737-3012759 CCATCCCCAGGGCGGCGGCGAGG + Intronic
1153909578 18:9695252-9695274 AGATCCTCAGTGAGGGGATGTGG + Intergenic
1155158622 18:23178124-23178146 GGATACTCATGGAGGGGGTGGGG - Intronic
1157417134 18:47513194-47513216 CAACCCTCAGGGAGGAGATGAGG + Intergenic
1160342590 18:78102234-78102256 CCATCCACAGGGTTGGGGGGAGG + Intergenic
1160739206 19:678109-678131 CCAGCCTCAGAGAGGGACTGGGG + Intronic
1160796809 19:949383-949405 CAGGCCTCCGGGAGGGGGTGGGG + Intronic
1161203748 19:3029484-3029506 CGCCCCTCCGGGAGGGGGTGGGG - Intronic
1162392326 19:10397013-10397035 CCATCATCAGGAAGGTGGTTGGG - Intronic
1162976179 19:14207969-14207991 CCCACCCCAGAGAGGGGGTGCGG - Intergenic
1163157854 19:15449208-15449230 CCCTCCCCAGGGAGATGGTGGGG + Intronic
1163408067 19:17136019-17136041 CTGTCCTCAGGGGTGGGGTGGGG - Intronic
1163551786 19:17969550-17969572 CCCTGGGCAGGGAGGGGGTGGGG - Intronic
1164042460 19:21505793-21505815 ACATCCCCAGAGAGGGGGAGGGG + Intronic
1164378069 19:27706992-27707014 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1165096928 19:33414495-33414517 GAGGCCTCAGGGAGGGGGTGAGG - Intronic
1165755049 19:38288171-38288193 CCATCCTCCAGGAGGAGATGGGG - Intronic
1166182168 19:41116656-41116678 CCATATTGAGGGAGGGGGTGAGG + Intronic
1166276154 19:41755649-41755671 CAATCTGCAGGGAGGGGCTGAGG - Exonic
1166305747 19:41936084-41936106 GAAGCCTCAGGGTGGGGGTGGGG + Intergenic
1166317163 19:41995738-41995760 CCATCCCCAGGGAGAGTCTGGGG - Intronic
1166345657 19:42163620-42163642 CCTCCCTCAGGGAGGGACTGAGG - Intronic
1166350886 19:42197561-42197583 CCTTCCTCAGGGGTGGGGAGTGG - Intergenic
1166423224 19:42654210-42654232 CCATCTGCAGGGAGGAGCTGAGG - Intronic
1167130208 19:47580404-47580426 CCAACATCAGGGAAAGGGTGAGG + Intergenic
1167424937 19:49425345-49425367 GGATCCCCTGGGAGGGGGTGAGG + Intronic
1167557336 19:50204441-50204463 CCATTCTAAAGGAGGGGGTCTGG - Intronic
1168126385 19:54285797-54285819 CCAGGCCCAGGGAGGGTGTGGGG + Intergenic
1168175510 19:54625067-54625089 CCAGGCCCAGGGAGGGTGTGGGG - Intronic
1168498749 19:56875797-56875819 CCCTTCTCAGGGAGTAGGTGCGG + Intergenic
1168695280 19:58400741-58400763 CCAACCTCAGGGAGCAGATGAGG + Intergenic
925173665 2:1767666-1767688 CCAGCCCCACGGAGGGCGTGGGG - Intergenic
925909828 2:8566332-8566354 GCATCCTCAGTGTGGGGTTGAGG - Intergenic
925918548 2:8624186-8624208 CCGTGCCCAGGGAGGGAGTGGGG - Intergenic
926143688 2:10384160-10384182 CCACCCTGAGGGAGGAGGTCTGG - Intronic
926891844 2:17645304-17645326 CCAACCTTTGGGTGGGGGTGGGG - Intronic
927545604 2:23950013-23950035 CGATCCTTGGGGTGGGGGTGGGG - Intronic
927745754 2:25619000-25619022 CCATCCACAGGGAACAGGTGGGG - Intronic
927848132 2:26482240-26482262 CCTGCCTCAGGGGGAGGGTGAGG - Intronic
927979580 2:27366189-27366211 CCATGCCCGGGGTGGGGGTGGGG + Intronic
928809617 2:35206819-35206841 CCATCCAATGTGAGGGGGTGGGG + Intergenic
929414127 2:41730057-41730079 TCATCCACTGGGAGGGGATGGGG - Intergenic
929598222 2:43189195-43189217 CCATCCTCCAGGAAGGGCTGTGG + Intergenic
930411232 2:51028270-51028292 CCATGCTCGGGGCTGGGGTGCGG + Exonic
931230044 2:60366398-60366420 CTGTCCTCAGGATGGGGGTGGGG - Intergenic
931612627 2:64119620-64119642 ACTTCCTTAGGGAGGAGGTGAGG - Intronic
932411767 2:71551704-71551726 ACATCCTCCGGGTGGAGGTGAGG + Exonic
932497040 2:72150830-72150852 TCATCCTCAGATAGGGTGTGGGG - Intergenic
933149864 2:78901622-78901644 CCATCCTCTGGGGAGGGGAGAGG - Intergenic
935142461 2:100365407-100365429 CAATCCTCAGGGACAGGCTGTGG - Intergenic
935268343 2:101413420-101413442 CGATCCTGAGGGAGCGGCTGCGG + Intronic
935626584 2:105176709-105176731 CCATCCTCAAGGGGAGGGAGAGG + Intergenic
935695684 2:105768963-105768985 CCAACCTCTGGGAGGGGTGGGGG - Intronic
936520628 2:113210114-113210136 CCAGCCCCAGGGAGGGAATGGGG - Intergenic
937626141 2:124046065-124046087 ACATCCTCAGGGAGGGGAGGAGG + Intronic
938322414 2:130373967-130373989 CCCACCTGAGGGTGGGGGTGGGG - Exonic
939742546 2:145927283-145927305 CTATCATTAGGGAGTGGGTGGGG - Intergenic
943579733 2:189671319-189671341 CCAACCTCTGGGAGGGAGAGTGG + Intergenic
943607870 2:189997461-189997483 CCATTGTGAGGGATGGGGTGTGG + Intronic
944393703 2:199246207-199246229 CCAGCCTTGGGGTGGGGGTGAGG - Intergenic
944687219 2:202128123-202128145 CCATCGGCAGGGAGGGGGAAGGG - Intronic
945285569 2:208078268-208078290 CCACCTTGGGGGAGGGGGTGTGG - Intergenic
947672424 2:231946698-231946720 CCAGCCTCAGGAAGAGGCTGAGG - Intergenic
948207363 2:236169119-236169141 CCATCCTCGGGGAGGAAGGGGGG + Intergenic
948456110 2:238105325-238105347 CCATCTTCAAGGGGGGGCTGGGG + Intronic
948844297 2:240675871-240675893 CCACCCAGAGGGAGGGAGTGAGG - Intergenic
948849561 2:240699008-240699030 CCACCCAGAGGGAGGGAGTGAGG + Intergenic
948858621 2:240742303-240742325 CCCTCCTGAAGGAGGGAGTGTGG - Intronic
1169232034 20:3896592-3896614 CCAGCCTCTGGGGAGGGGTGGGG + Intronic
1169264724 20:4160930-4160952 CCAGCCCCGGGGAGGGGGTGGGG - Intronic
1169469761 20:5874017-5874039 CCATTCTCTGGGAAGGGGAGGGG + Intergenic
1170460201 20:16570736-16570758 GCATCCTGAAGGAGGTGGTGGGG - Intronic
1171193769 20:23180799-23180821 GCAACCTCAGGGAAGGGGAGGGG - Intergenic
1171282645 20:23913984-23914006 CCATAATCAGGAAGGAGGTGTGG + Intergenic
1171770986 20:29323651-29323673 CCACCTTCAGGGAGAGGGTCTGG + Intergenic
1172633807 20:36395794-36395816 CCATGCTCAGAGCAGGGGTGTGG + Intronic
1172873022 20:38147497-38147519 CCAGGCTCAGGGAGGGGCTGAGG - Intronic
1173615460 20:44400540-44400562 GCCTGCTCCGGGAGGGGGTGGGG + Intronic
1173624912 20:44465732-44465754 CCTGCTTCAGGGAGGTGGTGTGG + Intergenic
1174158010 20:48529026-48529048 CCACCATCACGGAGGTGGTGGGG + Intergenic
1174282606 20:49450097-49450119 CCATCCTCAGAGGTGGGGAGAGG + Intronic
1174407213 20:50310209-50310231 ACATCCTCCGGGAGGGGCAGGGG - Intergenic
1174414706 20:50359042-50359064 ACATCCCCAGGGGCGGGGTGAGG - Intergenic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1175263971 20:57691576-57691598 GCTTCCTCAGGGATGGGGTAGGG + Intronic
1175267235 20:57710101-57710123 CCCGGCTCGGGGAGGGGGTGCGG - Intronic
1175598563 20:60254808-60254830 CCACGCTCGGTGAGGGGGTGGGG - Intergenic
1176310075 21:5144826-5144848 CCTTCCCCAGGGCGGGGTTGGGG + Intronic
1176359551 21:5983261-5983283 CCATCTGCAGGGATGGTGTGGGG + Intergenic
1178608209 21:34057551-34057573 CCTACCCCAGGGAGGGGGTCTGG - Intergenic
1179375809 21:40848926-40848948 CCAGCCACAGTTAGGGGGTGGGG + Intergenic
1179476729 21:41651332-41651354 CCATCCACTGGGAGGGGGGGCGG - Intergenic
1179655940 21:42844849-42844871 CCAGCCTCATGGTGGGGGCGGGG - Intronic
1179763967 21:43555289-43555311 CCATCTGCAGGGATGGTGTGGGG - Intronic
1179846981 21:44117206-44117228 CCTTCCCCAGGGCGGGGTTGGGG - Intronic
1179942032 21:44646572-44646594 CCAGGCTCAGGGAGGGGGCCGGG - Exonic
1180261275 21:46670801-46670823 ACATTCTGAGGGTGGGGGTGAGG - Intergenic
1180378654 22:12117620-12117642 CCATTCTCAGGGACGGGGACTGG - Intergenic
1180692861 22:17731974-17731996 CCATCATAAGGGTGGGGCTGTGG + Intergenic
1180702713 22:17790434-17790456 ACATCCTCAGGGAGCGCGCGGGG + Exonic
1180967264 22:19797211-19797233 CCAGGCTCAGGGAGCTGGTGGGG - Intronic
1181311868 22:21949295-21949317 CCAACCTAAGGCAAGGGGTGAGG + Intronic
1181529303 22:23507597-23507619 ACCTCCTCAGGGATGTGGTGAGG - Intergenic
1181939535 22:26464555-26464577 CCTTCCCCAGGGAGGAGCTGAGG + Exonic
1182084483 22:27551867-27551889 CCATCCTCAGCGTTGGAGTGTGG + Intergenic
1182555896 22:31128145-31128167 CTGTGCCCAGGGAGGGGGTGGGG - Intronic
1183382137 22:37495650-37495672 CCATCCTCTGGGACAGGGCGGGG - Intronic
1183535564 22:38398742-38398764 AAATCCTCCGGGCGGGGGTGGGG - Intergenic
1184565431 22:45288992-45289014 CCACCCACAGGGAGGCGGTGGGG - Intronic
1184646605 22:45898727-45898749 CCCTCCTCAAAGAGGGAGTGAGG - Intergenic
1184687946 22:46104834-46104856 CCATCCTCAGGAAGAGGGCAGGG + Intronic
1184769424 22:46588913-46588935 CCTTACTGTGGGAGGGGGTGGGG - Intronic
1184837366 22:47031860-47031882 CGTCCCTCAGGGAGGGGCTGAGG + Intronic
1184878176 22:47288690-47288712 CACTTGTCAGGGAGGGGGTGTGG - Intergenic
1185188507 22:49417873-49417895 CAACCCTCGGGGATGGGGTGAGG - Intronic
1185317032 22:50183741-50183763 TTATGCTCAGGGAGGGGGAGGGG - Intergenic
950464956 3:13148263-13148285 CCATCCTCACAGAGGGAGGGAGG + Intergenic
950502870 3:13375712-13375734 CGATCCCCAGGGAGGGGTGGGGG - Intronic
950562659 3:13743954-13743976 CCAAGCTCAGGGAGGTGGAGGGG - Intergenic
950566375 3:13772133-13772155 CAAGCCTCAGGGTGGGGGCGGGG + Intergenic
950673415 3:14540374-14540396 CCCTCCCCAGGGAGGGGCTGTGG + Exonic
951580336 3:24156563-24156585 GCATCTTAAGGGAGGGGCTGTGG + Intronic
953032861 3:39189397-39189419 CCATCCTCATGGTTGGTGTGGGG + Exonic
953169409 3:40493771-40493793 CCAACCTCTGGGAAGGGGAGAGG + Intergenic
953314541 3:41913955-41913977 CCCGTCTCCGGGAGGGGGTGCGG + Intronic
954596778 3:51831536-51831558 CCACACACAGGGAGGAGGTGAGG - Intergenic
954671654 3:52294344-52294366 ACACCCTCAGGGAGGAGGGGAGG - Intergenic
954850285 3:53594275-53594297 CCATCCTCAGGTAAGGCCTGAGG - Intronic
954877478 3:53811643-53811665 CCATCCTCTGTGAGAGGGCGGGG - Exonic
955217580 3:56997231-56997253 CCATCCTGAGGGAGGTCATGAGG - Intronic
956178856 3:66500098-66500120 TCGTACTCAGGGAGGGGGTGCGG - Intronic
960110457 3:113839994-113840016 CCAACCTCAGGGTGTGTGTGTGG - Intronic
960338232 3:116444864-116444886 CCATCCTCAGGTAGGGCTTTCGG - Exonic
960943135 3:122947476-122947498 CCATCCTGCAGGAGTGGGTGGGG - Intronic
961922957 3:130447029-130447051 CAATCCTCAGGGACAGGCTGTGG - Intronic
962243066 3:133767608-133767630 CCAACCTCAGGAAAGGGATGGGG - Intronic
963738500 3:149049986-149050008 CCATCGAGAGGGAGGGGGAGGGG + Intronic
964199756 3:154105756-154105778 CCAGTCCCAGGGATGGGGTGGGG + Intergenic
964450806 3:156810824-156810846 CCATCCTCGAGGAGAGGGTGAGG + Intergenic
968081202 3:195847881-195847903 CCACCCCCAGGAAGGGTGTGGGG - Intergenic
968089914 3:195893339-195893361 CCACCCCAGGGGAGGGGGTGAGG - Intronic
968578548 4:1379104-1379126 GCATCCTCAGGCACAGGGTGTGG + Intronic
968609965 4:1552452-1552474 CCATGCCCAGGGCAGGGGTGTGG - Intergenic
968628111 4:1637179-1637201 CCATGCTCGGGTGGGGGGTGGGG + Intronic
968921075 4:3522602-3522624 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968921088 4:3522636-3522658 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968921102 4:3522670-3522692 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968921115 4:3522704-3522726 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968944668 4:3657395-3657417 CCATCCTCATGGAGTTGCTGAGG - Intergenic
969506887 4:7593646-7593668 CCAACCTGGGGGCGGGGGTGGGG + Intronic
971853095 4:32009985-32010007 CCCTCCCCAGGGAGGCAGTGAGG + Intergenic
973613513 4:52658778-52658800 ACGTCCCCGGGGAGGGGGTGGGG - Intronic
974019070 4:56676945-56676967 ACATGCACTGGGAGGGGGTGGGG + Intronic
976246734 4:83012605-83012627 CCAGCTTCAGGGAAGGGGCGCGG + Intronic
976706052 4:88020456-88020478 CCATCCTCTGGTAGGGGGAGGGG + Intronic
977962437 4:103101171-103101193 CCTACCTCAGGGATGTGGTGAGG + Intergenic
979235267 4:118392838-118392860 CCATCAGCAGGATGGGGGTGGGG + Intergenic
980120239 4:128720538-128720560 CCTCCTTCAGGGAGGGGGAGGGG + Intergenic
985520941 5:373693-373715 CCAGGCTCAGGGAGGGCGGGGGG + Intronic
985524765 5:396240-396262 CCATCCTCAGGGGAGGCATGGGG + Intronic
985658514 5:1144129-1144151 CCACCCTCAGGGAGAGGACGTGG + Intergenic
985658525 5:1144161-1144183 CCAACCTCAGGGAGGGGACCTGG + Intergenic
986264584 5:6181151-6181173 CCTTCCTCAGGATGGAGGTGAGG - Intergenic
988538302 5:32087882-32087904 CCCTCCTCGGGGAGGAGGTCTGG - Exonic
988817622 5:34850364-34850386 CCATCCTCACTGAGGTTGTGTGG - Intronic
989237333 5:39164105-39164127 ACATCCTCAGGGAGAGAGAGGGG + Intronic
990410426 5:55535372-55535394 TCATCCCCATGGAAGGGGTGGGG - Intergenic
992378228 5:76210679-76210701 CCATCCTCCAGGAAGGGGAGAGG - Intronic
992388411 5:76308297-76308319 CCATGATCAGGAAGGGAGTGTGG - Intronic
993020518 5:82585252-82585274 CCCACCCCAGGGAGGTGGTGAGG - Intergenic
997261087 5:132465932-132465954 CCATCCTCTGGGAGGAGATGTGG + Intronic
997640210 5:135443995-135444017 ACATCCTAAGTGAGGGGATGTGG - Intergenic
998134589 5:139668089-139668111 CCAACCTCAGGTAGGGGGCCTGG + Intronic
998434117 5:142092666-142092688 CCAGCTACTGGGAGGGGGTGGGG + Intergenic
999180458 5:149666505-149666527 CCATCCTCACTCAGGGGATGTGG - Intergenic
999267403 5:150275914-150275936 CCATTCTCAGGGAGGGGAGGGGG - Intronic
999428219 5:151505389-151505411 CCACCCTCAGGGACTAGGTGGGG + Exonic
1000258243 5:159561058-159561080 TCCTCCTCAGGGAGGTTGTGTGG - Intergenic
1001195855 5:169673101-169673123 CCAACCTCTGGGAGGGGAGGGGG - Intronic
1001444539 5:171773235-171773257 TCAGTCTCAGGGAGGTGGTGGGG + Intergenic
1002183332 5:177442535-177442557 CCAGCCCCTAGGAGGGGGTGGGG + Exonic
1002845199 6:939211-939233 CCAAGCACAGGGAGGTGGTGGGG + Intergenic
1003602093 6:7526941-7526963 TCCTCCTCAGGGAAGGGGAGTGG - Intergenic
1005841957 6:29749336-29749358 CTATCCTAGGGGTGGGGGTGCGG - Intergenic
1006341997 6:33452247-33452269 ACACCCCCAGGGTGGGGGTGAGG - Exonic
1006454459 6:34123894-34123916 CCATCCTCAGGCTGGGGGCTGGG + Intronic
1007061111 6:38941897-38941919 CCATCACCTTGGAGGGGGTGGGG - Intronic
1007581124 6:42960785-42960807 CCACCCCCAGGGAGCGGGTCCGG - Exonic
1009290077 6:61870034-61870056 CCCTCCCCAGGAAAGGGGTGGGG + Intronic
1010230308 6:73528736-73528758 TCAGACTCAGGGAGGGGATGAGG + Intergenic
1010492270 6:76490376-76490398 CAATCCTCAGGGACAGGCTGTGG - Intergenic
1014004626 6:116403959-116403981 CCTTGATCAGGGAGGGAGTGGGG + Intronic
1015707504 6:136104048-136104070 CTGTCCTCAGGGAGGGTGAGGGG + Intronic
1018315718 6:162554576-162554598 ACATCCTCAGTGAGGTGGCGGGG + Intronic
1018387921 6:163321785-163321807 CCCTCCGCGGGGAGAGGGTGCGG - Intergenic
1018498132 6:164371025-164371047 CCATCCTTGGGGTGGGGGGGTGG + Intergenic
1018619674 6:165717808-165717830 CCATCCTCATGGGTGGGGAGTGG + Intronic
1018647328 6:165960781-165960803 CGATCCTCAGGCAGGGAGCGGGG + Intronic
1018785151 6:167102524-167102546 CCACCCAAAGGGAGGGAGTGGGG + Intergenic
1018932853 6:168253271-168253293 GCATACTCAGGGGTGGGGTGGGG - Intergenic
1021420102 7:20437332-20437354 CCATCCTCTGGGAAGGAGAGCGG + Intergenic
1022066507 7:26864380-26864402 ATTTCCTCAGGGAGGGGGTAGGG + Exonic
1022134108 7:27431450-27431472 CCATCATCAGTCAGGAGGTGAGG - Intergenic
1022410774 7:30136643-30136665 CCCTCCTCAGGGGGTGCGTGTGG - Intronic
1023996295 7:45161076-45161098 CCATCCTCAGGCAGGTGTTCTGG - Intronic
1024036679 7:45512718-45512740 CCATCTCCAGGGAGGGGAGGGGG - Intergenic
1026846336 7:73700876-73700898 CCCTCCTCAGGGTTGGGTTGGGG + Intronic
1026851581 7:73727026-73727048 CCATCCTCGGGGAGCAGGAGAGG + Intergenic
1026889335 7:73973078-73973100 CCATCCTCAAGCAGGGATTGGGG + Intergenic
1026988696 7:74570929-74570951 CCATACGCAGGGAGGAGCTGTGG - Intronic
1027052693 7:75029829-75029851 CCATGCTGAGGGAGGGGGTTAGG + Intronic
1027363491 7:77433156-77433178 CAATCCTGAGCAAGGGGGTGCGG + Intergenic
1028292553 7:89084232-89084254 CCAGTCTCAGGGAGTGGGAGTGG + Intronic
1028482472 7:91322618-91322640 TCATTCTCAGGGATGGGTTGGGG + Intergenic
1029269225 7:99366805-99366827 CGATCCTCAGTGTTGGGGTGGGG - Intronic
1029443206 7:100599642-100599664 CCTTCCTCAGGGTGGTGTTGGGG + Intronic
1029791227 7:102845142-102845164 CCATCCTTTGGGAAGGGGAGAGG - Intronic
1030615920 7:111738229-111738251 CCAAGTTCAGGCAGGGGGTGAGG + Intronic
1032614993 7:133458867-133458889 CCCTTCACAGGGCGGGGGTGTGG - Intronic
1033661694 7:143407480-143407502 GTCTCCTCAGGGAGGGGGAGAGG - Intronic
1033854922 7:145548548-145548570 TCATCCTCATGGAGATGGTGGGG + Intergenic
1035560869 8:602604-602626 CCAGCCTCAGGGAGGGGCCTGGG - Intergenic
1035619064 8:1024161-1024183 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619098 8:1024271-1024293 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619118 8:1024326-1024348 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619138 8:1024381-1024403 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619158 8:1024436-1024458 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1036163716 8:6411805-6411827 GCATCCACTGGGAGGGGTTGGGG + Intronic
1037913638 8:22758990-22759012 CCATCTGCAGGGAGGGGGCGAGG + Intronic
1038435370 8:27532097-27532119 CCAACCGCAGGGTGGGGGTCTGG - Intronic
1039536909 8:38324767-38324789 CCATCCTCCGAGAAGGGGAGTGG + Intronic
1040110329 8:43564367-43564389 CCGGACCCAGGGAGGGGGTGGGG - Intergenic
1041093456 8:54326279-54326301 CCAAGCTCAGGGTGGGAGTGGGG - Intergenic
1041197765 8:55418205-55418227 CTGTACTCATGGAGGGGGTGTGG + Intronic
1044727348 8:95204215-95204237 TTATCCTCAGGGAAGGGGTTGGG - Intergenic
1044824432 8:96182825-96182847 TCATCCTATGGGTGGGGGTGGGG + Intergenic
1045358626 8:101411861-101411883 CTATTCCCAGGGAGGGTGTGGGG - Intergenic
1045473931 8:102537384-102537406 TCATCATCAGCGTGGGGGTGGGG + Intronic
1045506268 8:102780960-102780982 ACAGCCTCAGGGAGGGTGGGAGG + Intergenic
1047769567 8:128020037-128020059 CCAGCCTCAGTGAGGGGTGGTGG - Intergenic
1047915884 8:129583278-129583300 CTATCCTCATGGCCGGGGTGGGG + Intergenic
1048261617 8:132950023-132950045 CCACCCTGAGGGCTGGGGTGTGG - Intronic
1048329309 8:133461259-133461281 CCAACATCAGGGAGGAAGTGGGG + Intronic
1048831232 8:138479318-138479340 CCAACCTCCAGGATGGGGTGAGG - Intronic
1049191917 8:141293062-141293084 CCAGCCTCAGTAGGGGGGTGGGG - Intronic
1049296880 8:141845488-141845510 GCTTCCTCAGGGGTGGGGTGGGG - Intergenic
1049934230 9:485159-485181 CTGTCTTCAGGGAGTGGGTGTGG + Intronic
1053288677 9:36865944-36865966 CCATCCTCGGGCAGGTGGGGTGG + Intronic
1053412749 9:37926194-37926216 CCATCCTCAGGGTGGGGGTGGGG - Intronic
1053428389 9:38026044-38026066 CCTTCCTTGGGAAGGGGGTGGGG - Intronic
1055478615 9:76688104-76688126 CCAGCTTCAGGGCAGGGGTGAGG - Intronic
1057128563 9:92637967-92637989 CCTTCCCCAGGTAGGCGGTGGGG - Intronic
1057217424 9:93236778-93236800 GCACCCTCAAGGAGGAGGTGTGG + Intronic
1057631877 9:96725830-96725852 CCATCCCCAGGGATGGGCGGAGG + Intergenic
1058901601 9:109447064-109447086 CTCTCCTCAGAGAGGTGGTGAGG + Intronic
1060208191 9:121694769-121694791 CCATCCACAGAGAGGGGCGGGGG + Intronic
1060257932 9:122048766-122048788 TCATCATCATGGAGGGGGAGTGG - Intronic
1060744929 9:126125053-126125075 CCATCATCAGTGACGTGGTGTGG + Intergenic
1061806617 9:133140664-133140686 CCAACGTGGGGGAGGGGGTGGGG + Intronic
1062069812 9:134549579-134549601 CCAGCCTGAGGCTGGGGGTGGGG + Intergenic
1062080384 9:134620487-134620509 CCAGCCTCAGGGAGGACATGAGG - Intergenic
1062108474 9:134768500-134768522 CTATCCGCAGGGTGGAGGTGGGG - Intronic
1062169181 9:135125124-135125146 CCATCCTCAGGGGGGTGAGGTGG + Intergenic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062383724 9:136299866-136299888 CCAGCCACAGGGAGTGGGTCTGG - Intronic
1062534026 9:137013713-137013735 CCAGCCTCAGGTGTGGGGTGAGG + Intronic
1062615852 9:137395354-137395376 CCATCCTCAGGGCCGGGCCGAGG + Exonic
1186055457 X:5644786-5644808 TCATGCTCAGCGCGGGGGTGCGG + Intergenic
1187935504 X:24331955-24331977 TCATACCCAGGGAGGGGTTGTGG + Intergenic
1189255069 X:39631616-39631638 CCATCTTCAGAAAGGGGCTGTGG - Intergenic
1189468107 X:41293219-41293241 CCCTCCTCAGGGAAGAGCTGGGG - Intergenic
1190597128 X:52061444-52061466 TCATCTCCAAGGAGGGGGTGTGG + Intergenic
1190611696 X:52192629-52192651 TCATCTCCAAGGAGGGGGTGTGG - Intergenic
1191125159 X:56946666-56946688 CAATCCTCAGGGACAGGCTGTGG + Intergenic
1191828435 X:65390631-65390653 CCATGCTGAAGGTGGGGGTGGGG - Intronic
1191895639 X:65989631-65989653 TCATTCTCAGGGATGGTGTGAGG - Intergenic
1192168075 X:68838460-68838482 CCATCCTCAGGCTGGGGGTGGGG - Intronic
1195049312 X:101082425-101082447 CCATCCTAAGGGCGGGGGGTGGG + Intronic
1196098330 X:111823346-111823368 CCATCTTCAGGGAAGGAGGGAGG - Intronic
1196144823 X:112305114-112305136 GCATGCTCATGGAGGGGATGGGG + Intergenic
1196784647 X:119411169-119411191 CCTTCCTCAGCGAGGGAGTCAGG - Intronic
1197195907 X:123700495-123700517 CCATTCTCGGGGCGGGGCTGGGG + Intronic
1197772497 X:130098113-130098135 CCATGGGCAGGCAGGGGGTGTGG + Intronic
1198423943 X:136496924-136496946 CCATCTTAGGGGAGTGGGTGGGG - Intergenic
1199680114 X:150218228-150218250 CCATGCTCAGGGAGGGACTTGGG + Intergenic
1200059359 X:153477331-153477353 CCATCCCCAGGCAGGGGGAGGGG + Intronic
1200115455 X:153767931-153767953 CCATCCACAGAGAGGGGGGATGG - Intronic
1200142734 X:153909943-153909965 CCAAGCTGTGGGAGGGGGTGTGG + Intronic
1201017843 Y:9623838-9623860 GTATCCTCAGGGAGGAAGTGTGG - Intergenic
1201475553 Y:14377447-14377469 CAATCCTCAGGGACAGGCTGTGG - Intergenic