ID: 1139717261

View in Genome Browser
Species Human (GRCh38)
Location 16:68823478-68823500
Sequence TGGTCACTTGGTCTTTATTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139717261_1139717268 10 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717268 16:68823511-68823533 CAGCGTGTGTGACTGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 206
1139717261_1139717266 8 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717266 16:68823509-68823531 GTCAGCGTGTGTGACTGTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 270
1139717261_1139717270 27 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717270 16:68823528-68823550 AAGGGGCCGCTGGCGTCTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1139717261_1139717269 17 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717261_1139717267 9 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717267 16:68823510-68823532 TCAGCGTGTGTGACTGTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139717261 Original CRISPR TGGTCACTTGGTCTTTATTC TGG (reversed) Exonic