ID: 1139717263

View in Genome Browser
Species Human (GRCh38)
Location 16:68823490-68823512
Sequence TGACCTCTAAGGTGGTCACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139717263_1139717266 -4 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717266 16:68823509-68823531 GTCAGCGTGTGTGACTGTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 270
1139717263_1139717267 -3 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717267 16:68823510-68823532 TCAGCGTGTGTGACTGTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 192
1139717263_1139717270 15 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717270 16:68823528-68823550 AAGGGGCCGCTGGCGTCTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1139717263_1139717268 -2 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717268 16:68823511-68823533 CAGCGTGTGTGACTGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 206
1139717263_1139717269 5 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717263_1139717271 19 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717271 16:68823532-68823554 GGCCGCTGGCGTCTGTAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139717263 Original CRISPR TGACCTCTAAGGTGGTCACT TGG (reversed) Exonic