ID: 1139717264

View in Genome Browser
Species Human (GRCh38)
Location 16:68823498-68823520
Sequence ACACACGCTGACCTCTAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139717264_1139717269 -3 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717264_1139717270 7 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717270 16:68823528-68823550 AAGGGGCCGCTGGCGTCTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1139717264_1139717273 30 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717273 16:68823551-68823573 AAGGCACAGCCTGTCGAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 108
1139717264_1139717268 -10 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717268 16:68823511-68823533 CAGCGTGTGTGACTGTGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 206
1139717264_1139717271 11 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717271 16:68823532-68823554 GGCCGCTGGCGTCTGTAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139717264 Original CRISPR ACACACGCTGACCTCTAAGG TGG (reversed) Exonic