ID: 1139717265

View in Genome Browser
Species Human (GRCh38)
Location 16:68823501-68823523
Sequence GTCACACACGCTGACCTCTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139717265_1139717269 -6 Left 1139717265 16:68823501-68823523 CCTTAGAGGTCAGCGTGTGTGAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717265_1139717273 27 Left 1139717265 16:68823501-68823523 CCTTAGAGGTCAGCGTGTGTGAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139717273 16:68823551-68823573 AAGGCACAGCCTGTCGAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 108
1139717265_1139717271 8 Left 1139717265 16:68823501-68823523 CCTTAGAGGTCAGCGTGTGTGAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139717271 16:68823532-68823554 GGCCGCTGGCGTCTGTAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 78
1139717265_1139717270 4 Left 1139717265 16:68823501-68823523 CCTTAGAGGTCAGCGTGTGTGAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139717270 16:68823528-68823550 AAGGGGCCGCTGGCGTCTGTAGG 0: 1
1: 0
2: 0
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139717265 Original CRISPR GTCACACACGCTGACCTCTA AGG (reversed) Exonic