ID: 1139717266 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:68823509-68823531 |
| Sequence | GTCAGCGTGTGTGACTGTGA AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 296 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 24, 4: 270} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1139717263_1139717266 | -4 | Left | 1139717263 | 16:68823490-68823512 | CCAAGTGACCACCTTAGAGGTCA | 0: 1 1: 0 2: 2 3: 8 4: 86 |
||
| Right | 1139717266 | 16:68823509-68823531 | GTCAGCGTGTGTGACTGTGAAGG | 0: 1 1: 0 2: 1 3: 24 4: 270 |
||||
| 1139717261_1139717266 | 8 | Left | 1139717261 | 16:68823478-68823500 | CCAGAATAAAGACCAAGTGACCA | 0: 1 1: 0 2: 1 3: 11 4: 149 |
||
| Right | 1139717266 | 16:68823509-68823531 | GTCAGCGTGTGTGACTGTGAAGG | 0: 1 1: 0 2: 1 3: 24 4: 270 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1139717266 | Original CRISPR | GTCAGCGTGTGTGACTGTGA AGG | Exonic | ||