ID: 1139717269

View in Genome Browser
Species Human (GRCh38)
Location 16:68823518-68823540
Sequence TGTGACTGTGAAGGGGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139717263_1139717269 5 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717264_1139717269 -3 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717261_1139717269 17 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717265_1139717269 -6 Left 1139717265 16:68823501-68823523 CCTTAGAGGTCAGCGTGTGTGAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139717269 Original CRISPR TGTGACTGTGAAGGGGCCGC TGG Exonic
900421554 1:2558013-2558035 TGTGACTGTGAGGGTCCCCCAGG - Intronic
900770703 1:4541215-4541237 TGTGACTGGGAAGGGGGGCCAGG + Intergenic
901000840 1:6148067-6148089 TGTGTCTGTGTAGGGGCCAGGGG - Intronic
901014990 1:6223799-6223821 TGTGAATGTGAAGGCGGCGTCGG - Exonic
902079434 1:13811271-13811293 TGTGAAGGTTAAGGGGCCTCTGG + Intronic
902386518 1:16079024-16079046 TGTGAGTGTGAGGCAGCCGCTGG + Intergenic
904744292 1:32701940-32701962 TGTGACAGTGAAGGGGTGTCGGG + Intronic
905329195 1:37180242-37180264 TGAAACTGTGAAGGGGCTGAGGG - Intergenic
907312666 1:53547898-53547920 TGTCTCTGTGAGGGGGCAGCAGG + Intronic
907516836 1:54998186-54998208 TGTGAATGTGAAGGGGATGGAGG + Intergenic
912373686 1:109193029-109193051 TGTGACTGTGGAGGGTTAGCAGG + Intronic
914856538 1:151355830-151355852 TGTGACTGTCAAGTGTCGGCTGG + Intergenic
914974847 1:152351889-152351911 AGTGACAGTGAAGGGCCCTCAGG - Exonic
915299648 1:154944756-154944778 TGTCACTGTGAAGGGGGAGATGG - Exonic
915883479 1:159698802-159698824 TGTGACTGGGAAGGGGAGGAGGG + Intergenic
916702874 1:167316090-167316112 TGTGACTGTCATGGGGTAGCAGG + Intronic
918012820 1:180603542-180603564 TGAGACTGTTAAGGGGCTGAGGG + Intergenic
920124325 1:203681602-203681624 TGAAACTGAGAAGGGGCCTCAGG + Intronic
922476061 1:225907634-225907656 TGTGGCTGTGGAGGCCCCGCTGG - Intronic
922581036 1:226698101-226698123 TGTAACTGTCAAGGGGCCAAGGG + Intronic
1063467403 10:6256090-6256112 TCAGACTGTGATGGGGCCGGGGG - Intergenic
1068911298 10:62381214-62381236 AGTGACCTTGAAGGGGCGGCAGG + Intronic
1068954039 10:62805595-62805617 TGTGAGGATGCAGGGGCCGCTGG - Exonic
1069425773 10:68287564-68287586 TGGGATGGTGAAGGGGCCACAGG - Intronic
1069750848 10:70744146-70744168 CAGGACTGTGAAGGGGACGCTGG + Exonic
1070225661 10:74502425-74502447 TGTGATTGTGAAAGTGCTGCAGG - Intronic
1072459293 10:95604725-95604747 TGTCACTTAGAAGGGGCAGCTGG + Intergenic
1073582647 10:104682061-104682083 TGATACTGTGAAGGGGCTGGTGG + Intronic
1073824207 10:107301828-107301850 TGTGACTGTAAAGGGGTAGCAGG + Intergenic
1076693348 10:132234918-132234940 TGTGGCTGTGAAGGGACCTAGGG + Intronic
1077179618 11:1206544-1206566 TGGGCCTGTGTCGGGGCCGCCGG - Intergenic
1077409023 11:2394996-2395018 TTTGCCTGTGAGGTGGCCGCCGG + Exonic
1080168900 11:29274792-29274814 TTTCACTGTCAAGGGGCAGCTGG + Intergenic
1081730184 11:45366391-45366413 TGTGACTGTGCCAGGGCCCCTGG - Intergenic
1082939981 11:58694403-58694425 TGTGTCTGTGAAGGTGCTTCTGG + Intronic
1083743957 11:64724965-64724987 TGTGAGTGTGAGGAGGCTGCAGG - Intergenic
1084045543 11:66565892-66565914 TGTGACTGAGAAGGCCCAGCAGG + Exonic
1085463753 11:76710511-76710533 TGGGACTGGGAAGAGGCAGCAGG + Intergenic
1092149197 12:6235669-6235691 TCTGCCTGTGAAAGGGCCCCAGG + Intronic
1092339617 12:7664235-7664257 TGTGAGTGTGATGGGGCAGAAGG - Intronic
1098071358 12:66679124-66679146 TGTGATTGTGAAGGGGGAGGAGG - Intronic
1100979936 12:100155892-100155914 GGTGACTGGGAAGGGGTGGCTGG + Intergenic
1102262610 12:111453648-111453670 CGTGTGTGTGCAGGGGCCGCCGG - Intronic
1102903600 12:116658043-116658065 TGTGATTGTCTAGGGGCCCCTGG - Intergenic
1103598975 12:122042092-122042114 TGTGCCTGAGAAGGGGGTGCAGG + Intronic
1104402469 12:128487755-128487777 CTTGACTATGAAGGGGCCCCAGG - Intronic
1105853168 13:24353701-24353723 TGTGTCTGTGAGGGGGTCTCTGG - Intergenic
1110504578 13:76270889-76270911 TGTGACTGTGAAGGTGTTTCTGG - Intergenic
1113384287 13:109834002-109834024 GGTGACTATGAAGGGGCAGCAGG - Intergenic
1113488816 13:110676420-110676442 TGTGACTGAGTGGGGGCGGCAGG + Intronic
1117803534 14:59467597-59467619 TGTGAGTGAGATGGGGCCGAGGG - Intronic
1119845451 14:77826181-77826203 TGTGCCTGGGAAGGGGGAGCTGG + Intronic
1120871108 14:89338221-89338243 TGTGACTGTAAAGGGGAGGAGGG + Intronic
1122082852 14:99278536-99278558 TGTGTGTGTGATGGGGCCGGCGG - Intergenic
1122430376 14:101636395-101636417 AGTGACAGTGACGGGGCGGCAGG - Intergenic
1122438935 14:101717078-101717100 GGTGCCTGTGAATGGGCAGCCGG + Intergenic
1122481609 14:102050950-102050972 TGTGTCTGTGAAGGGCCCCAAGG - Intergenic
1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG + Intronic
1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG + Intergenic
1123058543 14:105584007-105584029 AGTGTCTGTGAAGGGCCCCCAGG + Intergenic
1128367968 15:67018189-67018211 TGTGGCTGAGAAGGAGCAGCTGG - Intergenic
1131179455 15:90230079-90230101 TGTGAGGATGAAGGGGCAGCAGG - Exonic
1131189154 15:90300409-90300431 GGTGACTGGGAAGGGGTGGCAGG - Intronic
1132842914 16:1986992-1987014 TGTGGCTTTGAAGGGTCCTCTGG + Exonic
1133026618 16:2991443-2991465 GGTGGCTGGGCAGGGGCCGCAGG + Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1135325930 16:21525902-21525924 AGTGACTGTGAAGCAGCCGTGGG + Intergenic
1136412261 16:30084430-30084452 TGTGATTATGAGGGGGCCCCAGG + Intronic
1136545973 16:30954945-30954967 TGTTGCTGTGAAGGGGATGCAGG + Intronic
1138924661 16:61576495-61576517 TGTGACTGGGAAGGGACCCTGGG + Intergenic
1139296935 16:65909411-65909433 AGTGAATGTGAGGGGGCCTCTGG - Intergenic
1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG + Exonic
1139834933 16:69830622-69830644 TGTGAGTGTTGGGGGGCCGCGGG + Intronic
1140401440 16:74675050-74675072 GGTGGCTGTGAAGCGGCAGCAGG - Exonic
1141468896 16:84225308-84225330 TGTGACTTTGCAGCGGCCACTGG + Intronic
1141500582 16:84441574-84441596 TGTGATAGTGAAGTGGCCCCTGG - Intronic
1141534306 16:84668540-84668562 TGTGACCGTGCAGGAGCCTCAGG - Intergenic
1142077859 16:88130889-88130911 TGGGGGTGTGAAGTGGCCGCGGG + Intergenic
1142241375 16:88948386-88948408 GGTGACTGTGCAGGGGTAGCTGG + Intronic
1143537389 17:7549355-7549377 TGAGACTGCAGAGGGGCCGCTGG + Intronic
1143712671 17:8745037-8745059 TGTGGCTGAGAAGGGGCATCGGG + Intronic
1143724352 17:8835238-8835260 TGGGACTGACAAGGGGCTGCAGG + Intronic
1146920099 17:36704389-36704411 TGTGCCTGTGCACGCGCCGCGGG + Intergenic
1147042944 17:37731923-37731945 TGGGAGTATGAAGGGGCCGTGGG + Intronic
1147374946 17:40017752-40017774 TGTGACAGTGGAGGGGACACTGG - Exonic
1147878109 17:43636020-43636042 TAGGACTGAGAAGGGGCAGCCGG + Intergenic
1148552663 17:48559857-48559879 TGAGCCTGTGAAGGGGTGGCAGG + Intronic
1152334874 17:79695106-79695128 TGTGACTGGGGAGGGGCTGAGGG - Intergenic
1157623311 18:49028335-49028357 TGGAAATGTGAAGGGGCCTCTGG + Intergenic
1160859467 19:1231532-1231554 TGTGTGTGTGAGGGGGCCACAGG - Intronic
1161139982 19:2641490-2641512 TGTGGCTGTGAAGGGGGAGGAGG + Intronic
1163324586 19:16595013-16595035 TGAGACTGTAGAGGGGCCACCGG - Intronic
1164519168 19:28964645-28964667 TGTGGCTATGAAAGGGCAGCAGG + Intergenic
1165166910 19:33863372-33863394 TGTGACTGGAAAGGGGCTGGTGG - Intergenic
1166196182 19:41207331-41207353 TGTGTGTGTGGAGGGGCAGCAGG - Exonic
1167492081 19:49798806-49798828 TGCGGCTGTGAAGGGGCGGCTGG + Exonic
1167593507 19:50416374-50416396 TGTGACTGCCATGTGGCCGCAGG + Exonic
1167693596 19:51001715-51001737 TGTGAGTGAGAAGGGGCGGAGGG + Intronic
925827541 2:7864095-7864117 TGTGCCTGTGTGGGGGCCGGGGG + Intergenic
928699351 2:33883075-33883097 TGTGTCTGTGAAGGTGTTGCCGG + Intergenic
941510582 2:166403383-166403405 TGTTAATGTGTAGGGGCCACTGG + Intergenic
942270193 2:174266611-174266633 TGTGTCTGTGAAGGTGTTGCTGG - Intergenic
942447693 2:176088875-176088897 TCTCACTGTGAAAGGGACGCAGG - Intergenic
944481612 2:200163165-200163187 TGTGACTGTAAAGGGGCAAAAGG + Intergenic
945785603 2:214232570-214232592 TCTGACTGTGAAGGAGTCGGGGG + Intronic
947523700 2:230866067-230866089 TGTGTCCGGGAAGGGCCCGCAGG + Intronic
947726941 2:232406976-232406998 TGTGTGTGTGTAGGGGCAGCTGG - Intronic
948438097 2:237967304-237967326 CGTGAATGGGAAGGGGCCGCGGG + Intronic
948722585 2:239910979-239911001 TGTGACTGTGGTGGGGTGGCTGG - Intronic
948836677 2:240629293-240629315 TGGGACTGGGATGGGGCCTCAGG + Intronic
948939614 2:241189334-241189356 TGTGACCATGGAGGCGCCGCAGG - Intronic
1169251028 20:4061195-4061217 TGTGACTATGCAGAGGCTGCAGG - Intergenic
1169487012 20:6042189-6042211 GGAGGCTGAGAAGGGGCCGCTGG + Exonic
1172090134 20:32424946-32424968 TGTGACTGGGAAGGGGCAGTGGG - Intronic
1173514919 20:43658274-43658296 AGTGACTCAGAAGGGGCCCCTGG + Intergenic
1175607006 20:60319338-60319360 TGAGACTGTGCTGGGGCGGCTGG - Intergenic
1175655172 20:60763682-60763704 TCTGACAGTGGAGGGGCTGCAGG + Intergenic
1175911163 20:62406204-62406226 TGTGGCTGTGCAGGGGCCTCTGG + Intronic
1176429649 21:6567914-6567936 TGTGACTCTGAAGGGGTCTTGGG - Intergenic
1177297469 21:19195256-19195278 TTTGACTGTGAAGGGGGGGCAGG + Intergenic
1179705043 21:43175376-43175398 TGTGACTCTGAAGGGGTCTTGGG - Intergenic
1180095299 21:45553650-45553672 GGGGACTGGGAAGGGGGCGCGGG - Intergenic
1180095512 21:45554095-45554117 GGGGACTGGGAAGGGGGCGCGGG - Intergenic
1180095647 21:45554376-45554398 GGGGACTGGGAAGGGGGCGCGGG - Intergenic
1180944847 22:19687038-19687060 TGTGACCGTAAAAGGGCAGCAGG + Intergenic
1181314220 22:21961400-21961422 TGTGACAGTGAAGAGGGCTCTGG - Intronic
1181537943 22:23556374-23556396 TGTGACAGTGAAGGGGCCCCAGG - Intergenic
1181660766 22:24346647-24346669 TGTGACTGTAAAAGGGCCCCAGG + Intronic
1183240943 22:36657955-36657977 TGAGACTGTGAAGTGGGCACAGG + Intronic
1185080154 22:48705223-48705245 TGTGGGTGTGAAGGTGCCGGGGG + Intronic
949796883 3:7861035-7861057 TGTCACAGTGAAGGAGCAGCAGG + Intergenic
951162726 3:19445329-19445351 AGTGATTGTGAAGGGGACACAGG + Intronic
952447808 3:33399664-33399686 TGTGACTCCGAAGGGGTAGCAGG + Intronic
952683993 3:36129327-36129349 TGTGGGTGTGAAGAGGCTGCTGG + Intergenic
952867340 3:37862460-37862482 TGTGAGTGTGCAGGGGCTGGCGG + Intronic
953027306 3:39152699-39152721 CGTGCCTGTGAATGGGCCCCGGG + Intronic
954072355 3:48152140-48152162 TGTGACTGTGACCTGGCAGCTGG - Intergenic
954874801 3:53795018-53795040 TGAGACTGGGAAGGGGCTGGAGG - Intronic
959356350 3:105334194-105334216 AGGGACTGTGAAAGGGCCACTGG + Intergenic
960914025 3:122679475-122679497 TGTGACCGTGAAGGGGAAGAAGG - Intergenic
961477023 3:127153339-127153361 TGTGACTCTGAAGAGGGCACAGG + Intergenic
964898977 3:161634472-161634494 AAGGACTGTGAAGGGGCCACTGG - Intergenic
967050046 3:185774699-185774721 TGTGACAGTTAAGAGGCGGCTGG + Intronic
968229192 3:196994636-196994658 TGTGCCTGTGTAGGGGCGGGAGG - Intronic
968549033 4:1213058-1213080 TGTGGCTCTGAGGGGGCCCCAGG + Intronic
975082154 4:70294858-70294880 TGTGACTCTGAAGGGTCAGATGG + Intergenic
979584912 4:122404262-122404284 TGGGACTGGGAAGGGGCTACAGG - Intronic
982774146 4:159425084-159425106 TATGACTGAGAAGGAGCAGCCGG + Intergenic
985607052 5:863409-863431 TGTGACTCTGAAGAGGCCCCGGG - Intronic
985722110 5:1494829-1494851 GGTGGCCGTGAAGGGGCGGCAGG - Exonic
986043498 5:4015867-4015889 TTTGACTGTGAAGGGAGAGCTGG + Intergenic
986101136 5:4612828-4612850 TGGCACTGTTAAGGGGGCGCAGG + Intergenic
986551484 5:8960992-8961014 TGTGACTGTGCAGGAGCCTCAGG - Intergenic
987405252 5:17518193-17518215 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987405697 5:17521627-17521649 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987406144 5:17525061-17525083 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987406591 5:17528495-17528517 TGTGTGTGGGAAGGGGCGGCCGG + Intergenic
987407105 5:17582476-17582498 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987407555 5:17585910-17585932 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987407806 5:17587675-17587697 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987408253 5:17591112-17591134 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987408701 5:17594546-17594568 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987409157 5:17597980-17598002 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
987409272 5:17598711-17598733 TGTGTGTGGGAAGGGGCGGCCGG - Intergenic
989210545 5:38855069-38855091 TGAGACTGTGTCGGGGCTGCAGG + Intronic
990207990 5:53450820-53450842 TGTGACAGTGAAGCAGCCTCAGG + Intergenic
991494290 5:67212343-67212365 TGTGACTGTGAAGGTGTTTCTGG - Intergenic
992385187 5:76277885-76277907 GGTGACTCTCAAGGGGCAGCAGG + Intronic
993524374 5:88946012-88946034 TGCGACTGTGAAGGAGGCCCTGG - Intergenic
997065596 5:130555568-130555590 TGTGACTGTGCTGTGGCCCCAGG - Intergenic
997266404 5:132497426-132497448 TGTGACAGTGAGGGGACAGCTGG - Intergenic
999308984 5:150539244-150539266 GGTGTGTGTGAAGAGGCCGCAGG - Exonic
1000122568 5:158211131-158211153 TGTGTCTGTGAAGGTGCTTCTGG - Intergenic
1000397649 5:160792450-160792472 TGTGACTGTGTTAGGGCCACTGG + Intronic
1002712144 5:181201835-181201857 AGAGACTGTGAAGCTGCCGCCGG + Intronic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1004302205 6:14468889-14468911 TGTGACTGAGAAGTGGTCACTGG - Intergenic
1006365575 6:33613251-33613273 TGTGACTGTGAAGGTGCCCCGGG + Intergenic
1006563773 6:34936402-34936424 TGTGACTGTCAAGCGGAAGCTGG + Intronic
1006883479 6:37359854-37359876 TGAGTCTGTGAAGGGACTGCTGG - Intronic
1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG + Intronic
1007790206 6:44304367-44304389 TGGGAGAGTGAAGGGGCTGCAGG + Intronic
1008031928 6:46706543-46706565 TGAGACTCTGAAGAGGCTGCTGG + Intronic
1011775131 6:90721694-90721716 TGTGACTCTGAAGGGGCCTTAGG + Intergenic
1014762343 6:125370665-125370687 TGTGACTCTGATGGGGCAGATGG + Intergenic
1018582763 6:165321799-165321821 TGTGTCTGTGAGGGTGCCTCTGG + Intergenic
1019030810 6:169009211-169009233 GGTGACTGGGAAGAGGCCACTGG - Intergenic
1019127387 6:169849793-169849815 AGTGTCTGTGCAGGGGCCACGGG + Intergenic
1019434838 7:1017325-1017347 TGTGCGGGTGAAGGGGCTGCAGG + Intronic
1020983509 7:15102448-15102470 TGTGTGTGTGAAGGGGCAGGTGG - Intergenic
1023086816 7:36579211-36579233 TGTGCCTGGGAAGGGACAGCTGG - Intronic
1024318539 7:48043425-48043447 TGCGTCTGTGTAGGGGCGGCGGG + Intronic
1025810473 7:64872339-64872361 TGAGACTGTGAGGTGGGCGCTGG - Intronic
1027610523 7:80354307-80354329 TGTGGCTGTGATGGAGCAGCAGG + Intergenic
1033451043 7:141462688-141462710 TGTGAATGTGAAGGAGACGGAGG + Intronic
1034265359 7:149777993-149778015 TGTGTCTGTGAAGGGGCAGCTGG + Intergenic
1035531793 8:358287-358309 TGGGACTGTGGAGGGGCGGCCGG - Intergenic
1039887234 8:41661854-41661876 GGTGACTGTAGAGGGGCCCCTGG - Exonic
1042289571 8:67155213-67155235 TGTGAGTGTGAAGGGGAGGGAGG - Intronic
1043329536 8:79097975-79097997 TGAGACTGAGGAGGGGCAGCTGG + Intergenic
1048512307 8:135073771-135073793 TGGGGCTGAGAAGGGGCTGCAGG - Intergenic
1048802327 8:138206017-138206039 TGTGTATGTGAAGGGGATGCTGG - Intronic
1049159246 8:141086761-141086783 TGTGACTGTGAGGGAGTCACAGG + Intergenic
1049402275 8:142433774-142433796 CAGGGCTGTGAAGGGGCCGCTGG - Intergenic
1050037519 9:1452942-1452964 GGTGACTCTGAAGGGGCAGCAGG + Intergenic
1055932088 9:81569523-81569545 TGTGTCTGTGAAGGTGCTTCTGG - Intergenic
1056913388 9:90724410-90724432 TATGACTGTGAAGGCGTCTCTGG + Intergenic
1056937266 9:90925517-90925539 TGTGACTGGGAAGGGGCATGTGG - Intergenic
1060040498 9:120296142-120296164 TGTGACTGGCATGGGGCAGCAGG - Intergenic
1060112930 9:120919439-120919461 TGTGACTGTTAAGAGGGTGCTGG + Intronic
1060266753 9:122116105-122116127 AGTGGCTCTGAAGGGGCTGCTGG - Intergenic
1061244048 9:129392204-129392226 TGTGACACTTAAGGGGCCCCAGG + Intergenic
1062013743 9:134280855-134280877 TGTGATTGGGAAGGGCCCGGGGG + Intergenic
1062496853 9:136836012-136836034 GGTGACTGTGGGGGGGCTGCTGG - Intronic
1062687933 9:137825563-137825585 TCTGACTGTGATGGGTCAGCTGG - Intronic
1186867737 X:13737466-13737488 TATGAGTGTGTAGGGGCAGCAGG - Intronic
1189323703 X:40100772-40100794 TGTAAATGCGAAGGGGCCGAGGG + Intronic
1189378474 X:40484239-40484261 TGTGATTTTGGAGGGGCCGGTGG - Intergenic
1189731731 X:44028039-44028061 TGTGAATGTGACGAGGCAGCAGG - Intergenic
1190084826 X:47386314-47386336 TGTGGTTGTGAAAGGGCAGCAGG - Intronic
1190382483 X:49853433-49853455 TGTGACTGTAAAGGGGTAACAGG - Intergenic
1191758562 X:64622570-64622592 TGTGAGTGTGAAGGTGATGCTGG - Intergenic
1195700932 X:107705095-107705117 GGTGACTGAGAAGGGGCCTTAGG + Intergenic
1195707252 X:107746585-107746607 TGTGTTTGTGAAGGGACAGCTGG - Intronic
1200012923 X:153133675-153133697 TGTGACTGTGTCGGGGGCGGGGG - Intergenic
1200026678 X:153266248-153266270 TGTGACTGTGTCGGGGGCGGGGG + Intergenic
1200149477 X:153944242-153944264 TGAGAGTGAGAAGGGGCCTCAGG + Intronic
1200249464 X:154545067-154545089 TGAGACTGTGCAGGGGCTGGTGG - Intronic
1200706705 Y:6449197-6449219 TGAGACTGTGAAGTGGTCACTGG + Intergenic
1200980806 Y:9261737-9261759 TGAGACTGTGAGGTGGTCGCTGG - Intergenic
1200981036 Y:9263500-9263522 TGAGACTGTGAGGAGGACGCTGG + Intergenic
1201027407 Y:9715511-9715533 TGAGACTGTGAAGTGGTCACTGG - Intergenic
1202129388 Y:21596240-21596262 TGAGACTGTGAGGAGGACGCGGG - Intergenic
1202129631 Y:21598006-21598028 TGAGACTGTGAGGTGGTCGCTGG + Intergenic