ID: 1139717269

View in Genome Browser
Species Human (GRCh38)
Location 16:68823518-68823540
Sequence TGTGACTGTGAAGGGGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139717265_1139717269 -6 Left 1139717265 16:68823501-68823523 CCTTAGAGGTCAGCGTGTGTGAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717264_1139717269 -3 Left 1139717264 16:68823498-68823520 CCACCTTAGAGGTCAGCGTGTGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717261_1139717269 17 Left 1139717261 16:68823478-68823500 CCAGAATAAAGACCAAGTGACCA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217
1139717263_1139717269 5 Left 1139717263 16:68823490-68823512 CCAAGTGACCACCTTAGAGGTCA 0: 1
1: 0
2: 2
3: 8
4: 86
Right 1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG 0: 1
1: 0
2: 3
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139717269 Original CRISPR TGTGACTGTGAAGGGGCCGC TGG Exonic